Description :
From Genome Similarity Track
Location :
Scaffold_1156:3048- 4195
Sequence
1147 bases(100 bases per row)
GACAAAAGACGCGAAATGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGC
TCTGCAGCGTCAAGGAGGTCGCAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGACCACGGGCATCG
AGTCCCGAGATGGCGTCTCCAGCCAGTCCCGACGCGGAAAATCGCGACGCGGAAAATCGCGACACGAAAACGCGCGGCGCAGATGACCCCGCCGGGAAGG
CCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGCCCGTCCTCCAGAAGTCCT
GGAGGAGCGGGTGGTGCAACGACTGCGCCTGGACCGCATCCACGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGCGGCGAC
GTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCACCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACTAGCCGAGAAGCG
ACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAAGGCGG
ACACCAGGGTATTGGCCCCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGACGAATGCACCGAC
TGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGT
CGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCATCACGAACCGCGCA
GACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCA
AGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTGCTA