Description :
From Genome Similarity Track
Location :
Scaffold_187:30479- 32200
Sequence
1721 bases(100 bases per row)
ACATTACACATAGTCAATTAAATTACAAGCGCACCCATTTAAATATTAAATGGGAAACGTACATACCGGAGTGGCGCCGGCTCGTTAGGAGACAGGTATT
TCTGAGATGCTCTTGTCATGTAAAACCATGTATCATCAAGATGACTAACGTCGTACATCGGATAGTACAGCAGTGTCGAATCGTCGGCAAATCGAAGGAT
GAAATCCATTCGCCCGCGCTTGTTCTCCTCCGTCAGCAGGATTTGCTAGAGTTGGTCGTCGCCATGATGTCATTGCGCTGGCGCCTTCTACAGAAAAGTA
GAGGTCGATACCCCTGTCACATGTGCCAAAGAGCGCAGTGTATAACGCTTACGATATGTCGCAGCCACCATTTTCTTATAAACTGCATTTAAATTAATCA
TTTCTTTTTCTTTCTTACCCTTGATTTGGATCGCACGTCTAAGAGGTCCGATGAGCGGACCATGGTGTCGCGATCAAGCTTCCATAGCCTCATTATCGAC
TTCACAGGACATGCATATATAGCGTCACTGACTCGAAATTAGTATGACTTACCTTCCTGTTAGCATTAGCACACTGTAGGAACGTACACATTATACCAGT
GCGTTCGATGTCCTTGAGTTTCTTCGATCGGAGCTTGGGTATGGTGCATATCTTCGACAATGAGAGCACTACTACCAAGGAAGATATGGCGTGTACTGTT
TAAAGTGATACATTCAATTCACCCAATTCATAAGGAAGCCAGAATTGTAGAGACAAGTTTGCGTGAAAATGGTCTAGAGAAGCGTCTTGTTTAGGCATCT
GTAACTATGCATCGAATGCGATGTAGCTTTCCGGGTATAGGTAGAGATTTTTAACATTTTCAAGCTGCTATTAAAGTTGTCAACCGTGACAATGGGTAGT
CTGCAGGCTCCGCAATCAGCGTCGGTGTGAAAAAGAAATGATTTGTTTTGAGTTGCTGATTTTACAGCTACTGGGTGTGTGAATACACGGACAACACTGG
CTGAAAGAACTTAGAATAAGCCTTATTTTCAGGTTCATCATCTAACCTGGCTAGATAAATGACCTAGTGTTTATTTTTTGTTGTTGACAAGAGACAAACA
CGTTGAAACGGAGCGAGTATTATCGTTATAACTACTTATGTAAATATTGCCCCAAATTCCAAATGCAGCCCTACTTTGGACATTTAACAATTACTCTTGC
TTTGTATAGGAACCTTACTCTGCCTGTACGTGTACGTGGAGTCTGGAGGCATCCACTTCAACTGTTTCTAATTAGTAGCTTGTGCTTTGTTAGTGCAAGC
GCGTGGTGCCCTGTTACACCTGGTAGCCCTTTGTAGCCTGTCCAACGACTTCGGACTTTCAATCCAAATGAACATGTTGCGTGATGAAGAAAGGACATAT
TTCACACGTGTGGTGAGCTACTCCCGTTTTAGTTAAATCACATGGGATGCTGTAATGGACCACATGACAGGATTAAAACAAATAAAATTAACGTTTACAT
TTGTAAGCAGGTGCTGTGCCCGAATAGCGGACACAGCGTAACAAACTATTATTGGCTCATTATTGGGGGTCTAAAGACCCAATATGGACCAATGATAAGA
TACCTGAAAATGAGTAGTTCCCGAAAGGCGGGAACACGGTTGTACATAGTATGATTAAAAATCTTTGCAACTAGTATGAATTAAAACAAAATAAAAATTA
GGGGTAAATCTACATGATACC