Description :
From Genome Similarity Track
Location :
Scaffold_6:304746- 307968
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02436predicted protein
Sappa_CBS223.65SPRG_02437Hypothetical protein

Sequence
3222 bases(100 bases per row)
TGCTGGCGGACAAGCCAGCGACGTACTCGCTACCGCCGCACTCGAATGGCGAGCTGCCGTGCGTCATCTTCAAGGAGCGCTGGGAAGAGAAGGAGGCCCG
GCTTCGCGCGCTCTCGCCGTGGGGGCACCTCCCGTCGTGGCGGCTCCTGCCCGTGATCGTCAAGGCCAACGACGATTTACGCCAAGAGCAATTCGCGTCG
CAGCTCATTCGGCAGTTCCACCAAGTGTTCCAGGAAGCCAAGTTGCCCGTCTTTTTGCGGCCGTACGATGTGCTCGCGACGTCCTCCACCTCGGGGCTCG
TCGAGGCGATCGCTGACACGATTTCGCTCGACTCGCTCAAGCGCAACCACCCGAACTTTGTGTCGCTCTCAGATTTCTTCGAGACGCGGTTTGGCGACGT
GACGACGTCGTCGGGCCAGGCCGCGCAAAAGGCGTTTGTCGAGTCGGTCGCGGCCTACTCGATTGTGTGCTATTTGCTGCAGATCAAGGACCGGCACAAC
GGCAACATCCTCCTGGACGCCGAGGGCCACCTCATCCACATCGACTTTGGCTTTATGCTCGGCAACAACCCGGGACAAGTCCACTTTGAGTCGGCGCCCT
TCAAGCTCACGGGGGATTTCGTCGAACTCATGGGCGGCCCGCGCTCGGCAGCGTTCCGCCGGTTCCGGTCGCTCTGCGTGCGGTCGTTCTTGGTCGCGCG
CAAGTACCGGTACCGCATCACGCTCCTTGCCGAGATGATGATTGCGGGCAACGAGGACCTCCCGTGCTTTGCCGGCGACCCGCGGGGCACGATTGACGCG
CTCGCCGAGCGCTTCCGGCCCGAGCTCAGCGTCAGCGAGTGCGAAGACTTTGTGCACCAGCTCATCGACACGTCGCTCGACAACTGGCGCACGCGCTGGT
ACGACAAGTACCAGCGCTGGTTCGTCGGCGTCTTTTAGATAGTACGATCCGCAACAAAACCACTATAGACGCTTTCTATCTTTGAGGTCTCGTCCTCCTT
GGCGGCATCGCTACACATTCGCTCGTCGTCATCGCCGCACATCACCTGTAGTTGGTCGTGTGCGGGGGGCTAGGGCTAGGGATATAAGATATTCTTATTT
TCTGGAGGGAACTATCAAACGGGAAACTCGCGGCAACGGAGGCCTTCAAGCAAGTGTCCATAGCGTAGGACCTCGAGATGCAACTGTGGTCCTGCGCGAC
GAACGACTCGACTTGCACGCACTCTGCACGAGCTTTCGAACAATGACTCTGCAAAACGGTGGACCGGCGCCAACGAAACGTTCAAAGACGGAGCATGGGG
CCGCTGCCCAAGCCTCGCAGCGCGGTGCCGTTGCCGCCACCGTCGCCACCGCCATCCAAGGGCCTTTCCACGTCGTCGACGGCAGCGACAACGGTCATCA
AGACGAAGAAGAAGATGAAGAAGACAAAGCACCCGCTGCAGAAAGGCCGCTTCACTTGGGGGCTGCGCATGCGCGCCAAGAAGCAAGACGTCGCTGCACG
TATGATCCAGCGGCTCTTCCGCAGCTACGCGGCCCGGTGTCGCCACATTGAGAACCGGTATCGCGTGCGCATGGCCATGACGCGCGTCAAGGCCCTCCAC
GTGCTCTTCGACCGGACGCACTGGCAGCAGGTCGACTTGCACGCACTCAAGCGCGCCGAGCTCGAGGATCTGGCGCTCCGGCTCGAGATCCCGGGGCTCA
CGGGCAAGAAGGGCCAGATCATCCAGTCGATCCAACACTGGATCGACCTGCGCCTGCACGTACGCGACGTGGCGATTGAAGCTGCGACGCGCGCCAACGA
CAAGAGGCTGCAGGGTACCAAGTCTATTCTTTCTACCGATACATACAGCATGCTCCTAGCCCAAGGCGGCGTGTACGTGCTGGCCGCGACACCCGAAAGC
CGACCTACCATTCTACGACCGCTCAGTGGTCGCACCATATCGGCTGTAGCTGCGGTGCGGAAGACTTCTAGAGCCTCGCGCGTCTCCTCTCACAATGACC
GTCTAGAACTTCGAGTCGGAGGCCGTGTACGCCCTGGACACGACCAAGGGCCTCGTCTGGCTCTGCAAAACGTCGGGCTTGGCGGCCCAAGTCGGACTCT
GCAGCACCCTGCGCGACGACGACGTCTTCACCGACCCGTACGCAGCGCAGTGGCTCGTGACGCCTGTCCCGATGCAGACGCTTCGCATGGGCCACATCCA
ATCGCTCTGCGTCGGCCACACGCATGCGGCGGCGCTCGCGTCCACGGGCGAGATGTACACATGGGGCAACAATCCGTACGGCCAACTCGGCCTCGACCAC
GCCGTGCGTGCGCGCCAGCCACCGTTCCTCGTCGGCGTCACCGAGACGTTCACGACCATCTCGATTGGCGTCGGCACGCAGCACTCGCTCGCCGCGTGCG
ACAACGTCAAGGAGCAGAACGGCGTCGTCTATGCGTGGGGCGGCAATGCCCACGGGCAGCTGGGGCTGGGGCTGGGAGGTACACTTGCTAATTCTCTTTT
TCTGTGTCTTTTGAATAATGCCGGTAGCCAACGCGACGGTGTCGACGCCGCAGCGGGTCGTGGCGCTTGACGGCAAGAATGTGCGCAAGGTCGCTTGCGG
CGCCATGCACTCGCTCGTAGCGACCGACACGGGCGATATGTATGCGTGGGGCTGCAACGACGGAGGTCTCGGCCTCTTCCATCTTGGATAACCAGCAAAC
CACGCGAGTAGGCCGCCTTGGGCTTGGCACAAGCGACACCCGCGTCTCCGAACCGAGGCGCATCGAAGGCCTGTCGCCGCCGTTCCGCTGTGCGATCGCG
GTGGCGTGCAGTGCGTGGCACTCGGCTGCCATTTTGGCCGAGAGCCCAGGCGCAAGCGTTGGGACGGTACGACCTGGCTTCTTGATGATAAGATCTCTCA
CGTCGGTCACATAGGTGTTTACATGGGGCACGGGCGTGTACGGCCAAGTACGGCGACGTATTGCAAGCTCGTGGTGTCTCATGAGCATGTCTAGCTGGGG
CTCGGCAGCAACCAAGTCGCGCAGAGCCCACAAATGGTGCCGCTGCCGCCAATGAAGGCGCCAAGCGATCCGCTCGAGAGCGTGCGAATGATTGCATGTG
GCTTACAGCACATGGCCGCACTGACGGTGCAAGGCCACCTGTACACGTGGGGCAGCAAGGACGCCTTTAGCCCCCTCCCACACCTTCTCTCTGCGAAGCA
CCGCTCCCCAGGCCGGATAACG