Description :
From Genome Similarity Track
Location :
Scaffold_84:30472- 34505
Sequence
4033 bases(100 bases per row)
TCTCAACTCTCAAGATTCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACGAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGACCAGATC
TACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAACACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAG
AACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGTTGGAATCGGCAATCTCGCAGGTTTTGCTGATCCCGCTACACC
ACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGACGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGT
CGGAGATCGGATCGACGATGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGAA
TCCGAATTTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCTGGGTCCCCTGCGGATCTTGACGCAGGTCAAGATCCGCTAACAAAACAAGGGAAA
GTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACATCGTATCTAAACCCAAACCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAGA
CGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTA
TCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGAAGATCCAAGGAGACCGGTGCGAGCACCA
ACGAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGA
GCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCA
CCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCG
GGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGCGAAGGCTCGGGATCCAGTACGCCCTACGCGTGATCTGACACA
ATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAACCGCCTCACGGATCCGGTCTCGCCAGTGGAA
CAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTACCTGGCCGACCAGGGTATGAGAGCGC
CCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGA
TCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGAAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCG
GATCTGAAGGAGTTCACGGGCAAGGATCAAGACGATGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATG
CTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCT
GCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATAATACACCGCTCGCCGCAGATCGGATGGATCCCCGCTAGAATACCTA
CATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGG
GAGACGTGGATCAGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTACGGGCGGTGGATCGCGCGAAACACCGCCA
GAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGA
ACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGAAGACAACT
CTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAATCAGGTGTTCACAGTGCGGATCCCG
GAAGCACACTGAATCTGGATGCTAAAAAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGT
GTGGCGAGATTCACGACGTCAGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGA
AGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACAT
CGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACATGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGA
GTTTGCCAGATCCGAAGTTTCTTCCACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACC
AAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCC
GTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGG
TGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGCTGGGTGCCAAGTGGATGAAAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTG
TACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCTGGTCAAGACGCCA
TCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGGTGAGATGCGGATCCAGCTCAGCGGACG
GCGACCGCTGTATGGAGCGAAGATGAGGATCATAAGGACGGATAAGACAGCCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGG
GTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCA
GCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCG
CCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTG
GATCGGCCTTCATATCCAACTCCGCGAAAGATC