Description :
From Genome Similarity Track
Location :
Scaffold_6:30472- 45183
Transcript NameFunction/comments
Phypl_g265copper-transporting ATPase, putative
Phypl_g266hypothetical protein
Phypl_g267conserved hypothetical protein

Sequence
14711 bases(100 bases per row)
CGACTCCGCAACATATTCCTTAATGTGTTGCGCTATTAGCGCAACTCAATTGGGTTATGTAGCTCTAATCAGGTGCGCAACACACCTGATGCTAGTGTTG
TCGCGCTTGAAGTCGCCTCCCAGAGTCGCAGTCTTCATTGCGCCGCGTGCTGTACCAGCGCCACCTACCAACGCACAAGAGttagagagagagagagaga
gaaagcGGACACATGGGCAAACGCAAGGGACGTCGCGCGACCGCGAGCCCAGCGCAGGGCGACCCCGTGACGCTTGAGACGTCGGAGCCTTcgtgcggcg
gcggcgtcaaGAGCGACGGAGGGGAGAccgccgcgtcctgctcTAgtggcgacgaggacgtcaACGTGGCGGAGGCTGAAGGAGGCTGCGCTGACGACTG
CTGTGCTggcgaagaggaggaggaggcagaGGACGACTGTTGCGCCTCGGAGGCGGCcccaggctgctgctcgtccacggctGAAGAGGAGGTGGCTGCC
AAGGAAGAGCCCGGGAAaactggctgctgctcgccgaaGCCGTCGGAGGATGAGACGGAAACAGAGCGGGCTTGTACGAGTAAGAACGAGCCCaagacgt
cgagctgctgctcgtcaaaGAAGTCGCAGGCCACTAGCAgctccggctgctgctcgtcaaaGGGCCTGGAGGTTGCAGTCGAGCCTGACGCTTGCTGCAC
atcgaaggagaaggcgtCGACTGGATGCTGCTCGAAGGAGCCGAAGGTTGAGGTTGAAGCTGATGGCTGCTGTGCCTCCAAGAAGGAGCCGGAGCAGTCG
gggtgctgctcatcgaAAGCTCAGGATCCGCCACTTCCGGAGAGATCTCCCAGCTTTTTGACGCGGTTGACGCAGTTCCGTGGCGATCGTGGAGCCACCc
tcgagaagcagcggaCGCGCTTGGACAGCTCAggaaggaagaggaagacgactGGGTCCCTGGAGATCCTCCGCTTGAACATCGGTGGCATGACATGCAG
CGGCTGCTGTACGCGTATCGAAAAGTTCATGAATACGCAGCGTGGTGTCGCGGACGTCAACGTGAGTCTGCTTACGAGTCGCGGCATCTTCCAGTTCGAC
CCGGAGTTAGTGACAGCGAAGCACATCGAGGAGACAGTGGCCACCTTGGGGTTTGAGCCCAGTGTGCTTTCCAGTGACGAACTGGTGAGTGTCGTCCTGC
ACCTCGGTCAGTCCGGAAGCTCCCGTCGAGCCAAGAAGTTGGCACTTGAGGTCGCTGGTGTCGTCTCAGCTGAAGATGTCGATGAACCGGTCGTATCCTC
GACTTCATCGGGCAAGGCATTGCTAGTGGAGTACAACCCAGACATGACAGGCGCCCGTACGATTGTTCGTCAACTATCGCGCGAGCTAGGCTTCACCGTC
CAAGCGTCGACTCCGCGCGCACCATCAGTTCGTGCTGGCGAGGAAGAAGTGCGACGCTTTACTCGACTCTTGTTTTGGAGTTGCTTGCTGTCACTGCCGG
TAATCTTCGTAGAGTTCGTGCTACCGGCGTTCTTTCCCTCCTCCGGCAGTAATCCAGCAGATACGGCTGTATGGGGAACCGCGAACCGCTTGAGTATCCG
AAATGGTGTGGAATTGGCGTGCGCAACGCCTGTGCTATTCATCGTGGCGCGGCCCATTCACGAGAGCGCATTCCTCGCGCTACGTTACGGCGGGCGTGTT
ACCATGGACGTTCTCATCTCGCTCAGTGCCTGCACGGCCTACGCGTTTTCCGTTTTCACTGTTGTAACTGGAGCGCTCGCAAAGTCGCAACCACAAGTGG
AGACGCCAGCCAAAGCTGAGACCTTTTTCCAGGTCACGGTACTGCTTGTTACTCTCATTCTCGTCGGCCGCTACATCGAAACACTGGTGAAAGCCCGTGC
CTCGAACAGCGTGGACGCATTACTGCGCATGCAAGCCAAAACAGCCATTTTACTCGAAGAGGGCCAGAAAGAGTTGTACATtgacgtggtgctcgtggag
cGAGGTGATATGCTAAAGGTACTTCCGGGTACGCGAGTGCCTACGGACGGCGTGGTTGTCGGAGGTGCTAGTTCCGTGGATGAGTCGATGGTGACGGGTG
AAGCTCGGAAGGTGCCCAAGGAGACTGGAGCGATTGTGATCGGTGGATCCATAAATGCGCAAGGCGTTCTGACCATGCGAGTAACTCACACCATTCACGA
ATCCATGCTGGCACGCATGGTGAGACTCGTAGGAGAGGCTCAGGCTTCTCGCGGAGTGCGCCAGAGCGTTGCGGATGGTGTGGCTGCATACTTTACAACG
TTCATCGTCATTCTGGCCGGCTTGATGTTCATGCTCTGGTACTCGCTCGCTAAACACGGTCAAGTGGATACGCAGGGCTGGGCTCCTTTCCCGTTCGCGC
TGCGCTTTGCGATTACGGTGCTAGTCATTAGTTGCCCATGCGCAATTAGCCTTGCCGTGCCAACTGCTGTGATGGTGTCGACGACAAAAGGTTCCCAGGT
GGGTATACTTTTCAAGGGGGGTCGCGccctcgaggcgctcgaggaagtGGATGTTGTCGTGTTTGACAAGACGGGTACGCTCACCACTGCGCAGCTTGGA
GTTGCTGGGGTCTTCACGCCACAAAATGACGTCAATAAGGCACAGCACTGGCGCTgcgtagctgcagcagagaGGGACAGTGAGCACTCCATTGGAAAAG
CGGTCGTGGCGCACGCTAAgacgcagctccaagatTCCCAAGTCGAAGATGCGCAGGGATTTGAAGCAGTTCCAGGATGCGGTGTCCACTGCACTGTGCT
TGGTGTTGATGTGCGACTTGGTTCTCTCACCTGGCTTAAGCAGCAGACGTACGGTGACTGTTGCGCTCTTAGGATTCCTCCTGAGTTTGTCGAAGCAAAC
CAACATTTCCAGTCCCAAGGCAGTATTGTGGTGTTCGTTGTCATTGATGGCGAGTTGGTATCTGCAATTGCGCTGCGAGATGCACCGCGCCCGGAAGCCA
AGCGTGTCATCGAGCAGCTGAAGCGCGAGGGGATTCAGCCGTGGATTGTTACCGGCGACCAGCGCGGCACGGCCATGACTGTAGCGACAGCACTCGGCGT
GCCTGAAGGCTCTGTGCTGGCTGAATGCCTGCCTCATCAAAAAGTAGACAAGGTTCGCCTTCTGCAGAGTTTGGGTCTGCGTGTTGCTTTTGTCGGAGAT
GGTGTGAACGACGCGCCCGCACTAGCAACGGCTGATGTTGGTGTTGCActtggagctggaactgACGTGGCGatcgacgccgccgacgttgTGCTGGTAA
AGGATGACCTACGTGATCTACTCAACGCCCGCGCGCTTTCGAACGCCACCAACAGACGTATCAAGCTTAACTTTGCTTGGGGGTTCATGTACAATCTGCT
CATGATGCCTATTGCGTGTGGCGCGTTGTACGCTCCGTTCGGGATTTGGATCCCTCCGGCCCTAGCTGGTCTGTCGGAACTACTATCGTCCGTCCCTGTG
ATCCTCCTCTCACTGCTGCTTAACTTTTGGAAGCCTCCGTTCGGTGGTGACTGGGGTCTCCTGCAGAAGCACGTGGCAATCGACGTGACGGAGTCGACGC
ctctgctgcagaagcagcactaATGTGCTGGGGAATGCCGAACCGACAAGCCCTAGGTAGAATATCTTGCTGAGAATCAACAGGTTTGTTATTGCTTATG
GCGAAGATTTGTTCTTTATCGTGCTTTGTGTTCCTACTAGCTAGGAGTAGAAGTCTTCGTGTATTCGAGGAATGCTGCTCTCGCGTGCGTTCGTGTTGCG
TGTGGGTCCACTGACAGTGTCGTatcgccaccagcgctgcCGGAGACAATAGCATCGAATCGgcgatgaagcagctcgatATCTTCACCAACAGGTACTG
CGAGATCACAGCTTTCGTTTTCGTTGTCAGCCGCACGCATGCTGCGAGCGACCATAGCGCCTGACCCGCAGGATGGATGTGCCGGTGTGGAGGCAGTCTT
GAGCTTTTCTCCCAGCCGACAGTCGTTCACAAAGGCATCGCGCCTGGCAATAGCCTCCTGCTCAGCTTGGTCCTCGCGCCGTTCCTGCCGttgcttctgc
tcctcgtctGGTTCGTCTCGTGCAGAGCGTGGATCAGGCGTCATCTTTAACTGGTAGCGTCGCTGGAGCGCCTTGAGCGAGAGAGCAAGATAGACACAAG
CTGAGGCACGTGTCGACATCTGCGGAAATTTGGGGCGTTCGCTGCCCAGTGCTAGCAGCACTTCGTTTAGcgcagctccaagctgctgctccaactGGCC
CGGATAGCTCTTGGATAGTGTCACCTGGGGTGGCAACTTCATTGGCAAGCTCTGTGAGGTGTATCGAGATGGTTCGACGCAGAACTGACGGCGTGCTTcc
tcggagacgaagaagTAAACTTTCGAGCGGTACGATGCGCGGAAGAAGACACTGCCATGGCGAAGTGCAGCCCAATCTTTGGCACCAGATCCCGATGCGA
AAGTGACCGGGCAGTAGCCTTTCATCTCGGGGAAGTCGCAGTCCGGCACCGTCAGCAAGCTCACGAGTGAAGCATTTACTGGAGCTCGAGCCACAAGTGT
CTGTGCCTCGCActccgcttcttcttgtgtCGGCCACGGTTCGTCTCCCCCCTGCACTGGAGTTTCATCGGGCAAGTATCCGACGAAAGCCTCAGGATTC
TCCACAAAGTGCTGTAGACTTCGTTCATTCCCAaaccagaagctggagtcCCGGAAGTCTACGCACAGGTCACGGTTGGATTCGCGCGAGTTGTAAAATT
TTCCGGCGTGCAGGTCGACAGGACAAAACGTCTGAAAAATAGGGTGCTGGCGCGCTTGTAGCTCTTCACGGGAACGCACCACACCTAGTGAGCGGGCAGC
TCGGTTGCAAGCCATTGCTCTGGTATATTGCGAGgccaactgctgctgctctttgAGGAACGCCTGTGCCTGGGCAGCTACATGCCAGAGCGAGTTGCTC
GAAATGTCAAGTTGCCGCACGTGGAATATGCCAAAGCGTCGAGTCCAAGtgtcaagcagctccagccggAAATGGTGCCATCGTGCAAATGCTGCCCGAA
GCTCGTTTCGCTCTACGTGAGTTTGATGATCCGTCCAGACACTGGCGAAGTCGCGCTCCAAGGCGAAGAGCATGTCAGGCCGGATACTCTGCGAGACAAG
CTCCGTTGTGCTGGAGTTTGATAGACTGCGTTGTAactcgtggcgctgcaacAAATATCCGTCAAGAGCCCAACCACGTGCCTGACACTCGGAGGAGCGC
AGACGAGCACAAATCGCCTCATGAGTGACGTCTGCGCTGGCTAGCggatcctgctgctgctgcgtgatCTCCAGCAATCGACACCGCAGTGTGGAGCCAC
CCTGACACTGTATCACCCATTCAAGTGCAGTTTTGGGGGATACGTAGACCAGTCCGAGCGCAATCGCGAGCTCCTGAGCCACGCGGGTCTTGCCTGAAAG
TGGAGGACCTACTACACAACAGGTCGGCGGATGCTTAGGTGGTTGACTTGCTTTGTCCAAGTATATTGAGGGACAAGACACAAAGGCACGTCGGGCTTCA
CGCGATCGAGGGAAGTAAAGCTGGTTCCGATGAACAACTGCTTTCATCGAGCTAGCCGATACGGAATCCGTACGCCCAGTAACGGGGCAGACAAGTCCGT
GTTTGCCTACAAACAGCTCTCCCGACGCTAGCATCTGATGCATTTTGCCCCCCGTCGTCATGTCAAGAACTTCGCAGCGTTCGAATAGCGTATCCCGTCC
TGCCATAAATTCATCAAGGATCCGCCTCACGTGCTTGACCATTTGTCGTGGTGCACTGGTCGCATCCACCGGGTCGCAGACTCGGATACCTCGTGCTCGA
AGCCCAGTCACAGCCTCATCCAGAGCTTTCTGGTCCTCTGCAAACTGTTCGCGCAGTCGAGTACTCTCTTCTTCACGCACTGCTTCCAAGTCGATGggct
cttcttcttcagcgtcttctggAAGGGTGCCATCGTCGTCCGCCTCTCCATCTAACTCCTTTTTCCGCATGAGAGCGAGCTttcgacgaggtgctggtaG
GTTGGCAGTCCATCGAGCAAGCAAAGTGTTGGAAACCATATCTTCCGACACCGTCAAAGGAACCACAAGAGCTGGAAAGAGTCCATTCTTGAAACACATT
TCCAGAGTCACTGCATTTGGGATGCGTGAAGCTTCCGGTCCCAACCCAGCAACAATTTGTGCTACAGCCCTTTGGTGAGTTGCGGGATGGCGTTGCAGTT
CtagttgaagcgctcggaCAAAGATTTCTTCGGCCGTCAAGCGTGCATCTTCCGGTTTGAGCTCTTCTAGAAGTTGGTTGCGTTCCACGGCCTTCGCAAC
TGTGGGCATGTCCACATTCACGTACTCTGCGGGAGAATCGATTTGCTCCACTTGTGGCtgagcaagtgctgcagcgattCGACCCCGTCCAGAACCTCGA
ACACCAAGTATCAAAACGCAAGGCACGAAGTTCGTAGTTGCGCAAGGGCCGTTGGGGATGAAGGCGGCTGGATTTCGCTCGAAGGTACGCCGCTCAGATT
CACCAGCGAAGGCGTAAAACTTCTGACGGAAAGAACAAACACTTGATGGCTGTCCAGGTATCAACAAGCCACGCGTACGCCAAGACACGGGACAAAAGCG
TCCACACTCCCCTTGAAGCTGTAGCGCTctgtttcttgctgcttcagcttgcgcttcaacCTCAGGGTCTGAGACCTCGACctcaccttctccttcctct
GGTGCCGATTTTTGTTTGTTCTGGTTCTCTTCATCCTTTTCGGGAACTGGTGGGGCGAATATCACGGCTGGATCGTATTCATCAACAAGCTTTGGGGAAT
GTCCGTCTTCGATGCTGTCCAAGCGTGGGGCAATGGGGTTAAGCTCGCGTTCGATAGCTGCAAGCGTATCGCCCGGTTGGCGGAAGAGTGGGCACGTTAT
GACTCGAGGCGCGCTACCAAGTCCTTGTGAGATGTCATCGGCACCAGCTTTCTCAGCCTGGAACTGCTGACGTCGCAGCACGGATAGAGCGCTAACAGCT
TCGATGCTCGttcctccttcctcttcttgagcagcggcgaccTCCCTATCCATCAGCAAAATTGCGTCGGGCACACACCCGTGCTCAAGTAAAACAGCGG
CAACATCGCGTGTGAGAGGCAGATCCGTGATCATCCACCCTGCCGGCGTGCTCGACTTGGCCAACAAGGCCttggcggcttcggcggccaccgttgcagc
ttcaacagGGGAGACAATCTGTCCGCCCATGAGGCGCATTTCCGTTGAAATGCTTGGTGAATTCTTGAGCAACTTCGAAGGTGACACCGTCTGCACATAA
AGCCCAGCttcgagcgtctccagaTACGAAGGTGTGAAGACTTCACCTGCGCCTGTGGTGACGAGCCAGAAGTTTCGATACGTGGATGGAACCGGGATAT
CCCGACGCAAATACTGCAACGGGTGTGCACAGAAGTCGCGTCGTGCGGCTTGTGATGTCAAAAGGTAGACCCGACCGGAGTAACCTGCAGCAAACTCCGG
CTCGCCAAGCCTCAGCGTGTTGGTAAAAGTCGACAGCACGGGACAAAACTCACGCCATTTCGATAGCTGTCGGCGTTTAGCATCGCGTTTAGGAAGTCGT
GCAAACGTCTCACTTGCTTCCGCTTCTAGAAGTGCACTCCAATCCCCATAGAGCAGCCAACGAACTTTCTCGCCGCGGCTAGAACTGTTCAGATCCTCTG
GCAGGGATATCGGACAAGCTTCGCGCGAGATGCTGCACCGCGACAAACCGAGTGAAGTCTAACAAATTTCATAAAGTCAAGACCACAAAAATCACGAGCC
ACTTGAGTGTCAAGCAGAAACAATCGTCTAGTGTCAGCAGAGCTACGTACGCCTGTGATCGCCTGGATGCAGTGATCTCGGATTACATTGAGAGATTGCG
TGGCCAAGACCACCACCAAGTGATAGTTCGACTGGTTGCCccctgcgtctgcagctcggcgcgctgAGAGCTCACGTTGCATTCGCGTCACGAATTCGTG
GAATCCCTTGGCGAGTTTTACCGCAGCCATGGATCCGAACGGTAACGTGGGCTCTGTAGGCGGCTCGATCTCGTTGCGTTCTGCAGGAGTCGGTTCTGTT
GGTGGTACAGGAGGTCCTTCCGGTGCATCTTGGCCGCTGTCTCCGTATCCGTCCTGGTCATTTTCTTCGGGCGAAGACTCCTCGACTTCTTGGCCCTCGT
TGTGTGGGCCAGCCTCGCCGTTTTCAGCAATAGTGGCGGGCTCTGGCAACACCTCAGCTTCTGCCTCCGGTTTCTTCGGTGGCAAGAGAAAATCTCCGAA
GCCTGTGGCAGCCAACTCCTCGCTGCTTGTCATCTTCAAAGTGGCAAGCTCTCGTACTGAGTACAAACGACCTGCTACTGGCGCCAACTCCGAGTCTTTG
AACTGGTACTCAATCTCACTGGGTAATGCTGTGAGAGCTATCAAATAGTCTGCCGCTATAGTGCGTTTGGGGTTATCTGAAGCTGACAGCTCACTCGGGT
ACACGTCATCCAGGACCACCCCAACGCCAGCTACAACAAACAAACCAGAAGTGAGTATTATTATTCATTGCTGCGATGATACACCAACGTACCGAGCAGG
GAACGCGTGGCTTCTATTCGCAGTACAGCAAGAGCTGATTCTCGTGGAAAAACGTTTCCTGTCCAAAGCGCATCGAGATGTTCATCCCGAAAAACCCGAT
CCATTTCTTCATCCGCATCGTCAGTCTCGACTTGTTCGGCTTCATGCGTTGTCTCTGCTAGTGGCGGTGTTTCCGCACttggttcttctccttctgcagg
tgcagcagcagcagttcggCGTCGGCGCAATCGGAGCTTACGGTCGACCGCACGCTGTACAGCTCCATCAAGTGACAAATACTTCAGTCCAAGTCGTCGT
GCTAGAACACGAGCAAGCCGCGTCTTGCCGCATCCAGGTGGCCCAACAACTGCGACTCTCAGAGCAGGACAGTCGGTAAGCGCAGCGGTGAGTGCATCTT
CCGGATTCCAGTGCGCTGCGGTCTCACGGTGAAGTTGTCTAACCCGAACGGGGGTCGCTCCTGAGCCAATAGAGcccatgagctccacgtGCAAGCGTCG
TGCAATCTCCATGTCGTCTTCAACGTCAGGTTTGGGCGTATCCGTCTTGGCTTCCTCTGCTACATTTGCTGTGGCATCAGCATTGGCCATTTTCGTGGGA
AATGCACGCGTGAGCGAGAATTTCCGCGGGTTGTAGCtgacaagaagctgcttgagcgACATCTCACGTTGGTCAGGCGGTTGCAGTCCCCGGATACTTC
GCATGGCAGCACTTGATGGTGGAACCTTTTGCAGGAACGCGTCGTTGGCAATTTTCGGGATTCGCTTCAGTGGTCTCAACGTGAAGCGGCCCCCTGGATC
AGCCGAATTGGCCTCATCCTGCTCCggtttgctgctggaaggagaGACGACAAGCTCCGCGACGGAGTTGCGTAGCTCCCGGAAGAACGTTAAGTAAACG
CCTGCTGCACTCTCCACGGGAAGAATCATTTCTGCGAGCTGCATGACAGCTTCACGAAATTGTTCTGGTGTCATAACTTCGTTGTGCAGACTTGACGGTG
CTTTGGTGGTAGGATCACCGATaccaccagcgccttctAAATCGTATTCCCAGTCACGTTGTGCCGCGGCAATGGCAAGTGCATCACttgacagcggcag
caccagcgcttTAGCGGCTCGAGCGAAAAACGCGACGTATCCGTCTCGACTCAAAGTGCAGGAAGTCATGAGTTTGGCCAAATCCCAGAGCAGCGTCAAT
TCTCGGGCTACCAACGCATTTGCTTCCCCCCCGCTGGCACATTCGTCACCTTCCAGCATGGCATTTCGACGATTGTGCCATAGTCGAAGCAGGTTGGCCT
TGCCCTCGCCGACACTGCGTTCCTTTTCGTCCTCAGCGAAGAGGAAATGCCGACGCATCGGGAACTCGAAGGCGTTCTTGATGTCACCAAGCTGTGAGGT
GGGGAATCCACTGCAATGGAGTGCTCTAGCGACGCGTCGGACTTGGAAGAAGACGACTGAAGGCAAAAGTGGTTGGTTTCGTTTTTTGTATTCCCGTTTT
TAGTTGGGGGTTCTACACTCGCTGGGAGTGCTAATAAGCGTGTCTTGAGTAGACACGAGTTGGAATGTTTTTAGTAGGCTCTAAGCTAGACTTCGGGATG
TGAGGGTGACACGAGTCGAGTCGAGTGCAATTTCTGCACTGCCGGTGCGAAcgcgcgtcttcttctcgctcggACGCTGGTGTTTCTTCATCAACTcctc
gcccttcttcttgatcatGCTGCCAATGGACTTTCGTCTAGACTGCTTGATAGTTGTGATCTCCTGCACCCAcgggtgctgcagcgctgccgtcACTGAA
AGTCTCGATTCGGGGTTCACATCGAGGAGACCAGCGAGTAGGTCGACGCACGAGGCTGGCACCTGCGAGAGGAGTCCGGTCTCCTGGAGCGCAGCGGCCG
TGCCGCGTTCGACCATTCGACTGAAGAGCTGGTCACTGTCGGTCGAGGCACTGCGTACCAAAGCACGCTTGGTGCACAGCGTCCACAGAATGACACCGAG
CGACCAGGCATCGGCGCGACGTGCATCTTCCACCTCAGTGTCACGTAGCAGCTCTGGCGCAGCATAGGCCTGCTTGGCGACTTGTACGACCTGAACACTC
GGTCGGTCGTGCTCGAATCGCTGGGCGTGGCCCAGGTCGCCCACCTTGACGACGCCGGATTCCGTGACGAAAACGTTCTCGGGGGATAAGTCCAAGTGGG
CGATTCCGGCGGAGTGTAGCGCCTGAACGCCTCGCAGCACAGCGGTAAACACACGACGTCGGCCAGCATCGGTGCATGTCATCATCAAAGAGCTCTGAGG
CGGCACGCCGGCCGTTTGAAGTCGACGTTCCTGTTGCATGATTTCCAGCAGGTCTCCACGAGCGCAATGCTCGTGGAAAAGGTGGAGTCTCTCCCCTTGC
AGCGAATGACGTTCCATCTTGACGACGTTCTCGGCATCCCGAACCGAGAGGTGCAGATCCAGTTCGTGCAGCGCAGCGGCACTTGCGCTGCGACCTTCAG
GGGCGGACGAGGTCATGAGAGTATACTTGTCGATGAACAGTCGACCGGAGGCGGAGCACTCCACCAGATCCACACACCGAAGACCATCGAGACTCTCCTG
TATACGCGAGCGCAGCTTTAATGGAGCTTCCAGGACGGGAGCCATGCTATATATTCTAGTATGTAGAGAGAACTTtgccaccttgacggcgTGTTGGAAA
GTGAGGCAGCCAGCCCGGCGACTATATTTACCTAGTAACGAacggcgcagcagccagtagGTCCATGTTGTAGGATTTTGCCAGAGACTGTGTATTGCAG
AGGTTTGACGGTGATATGCAATCCAGCTGTATGAAAGCGCACGTCGGGAACGCTCTCTCCCCATAATACTGATATGCTCTGCTTGTACTGTCTCGAGTAC
GAGAAAGTTGTTGACCAAAGCACTTGAAGCGAGAAGCACGTCAGCGCCACAGCTGGCACGACATCCCATACTCACATTTACCAACTTTACCAACTACCAG
TTGCCTGCCGTTCTGCGTCCTGGAGCCACAAAGAATCACAATGACGTGCGTACAATGCAGACTTGGAAACGCGTCCCAGCAGTCCAATTCGCAGAGTTGC
TGGCTGCGTTTAAGCAGCTTTAAAAAAAGCTTAGGATACCACGACGTTCCGATACGACGACTAATGAGGCTTTCCCAAACTTTGTAGTTTTCAGACATCG
GCGGAGTGGAGACTGGTACTGGTGGTACAAAACGTGGGGAGTGGATACTGCAATTGAGACCCTCGTAGGAGCCGGAGCCGTTGACCAGTACTGTAGCAGT
GGGGATCGACCGAGAAGAACTCCCTTTCGACTGATCTGGGGACATCTGAGAGCTCCACATGGGCCCCATCCACGTGGATCTGGAGAGGAAGGTCTTTGTT
CCGGAGACTGCGATGGCGAGCTGCCAGTTGTTTAAACTGCCTTTGCTTTCCTTGCCCGTGCTTTTGGTATCGTTGGGCAAGCACCGAcccgctacatgta
catgacAGGTACTAGTGCTCCTTGAACCTGCAATGCAATCTGACATTCAGGGTGGACTGCGCGACAACGTCTGGGCAGAAACTGCGCTCGTGTCACATGT
TGAAGCGCCCGATCTAGTGAATGGGCGTGGTGCTGAATCCTTAAGTTAAGAttgccgcgctgctgctgtgggcaCGACCGAAACGCCTTCTTGTCCCAAG
TCCTTCTTGACCGGATGACGATCCCGCCGACGCGCGAGTATCTCGACGAGGACTCAGCCCTCGTGCATCCCAAGCAGGCCGCGTCGCCTGTAAAATCTGG
TGGTGCCGTGCTGGACTACAGCAATTCGTACCTGGGGGACGACAAGTTCGCGGAgatcgtggagaaggccCGGCTAGCGAGCATCCCGACGCGGCTGGAT
CTGCGTGGCAATTGCttcgaagctggagctgcacgagcactCGCGGCGCTACTGCGTTCCTCGCATAATGTGGTGGCCATCAGTCTGGAATGGAACAacg
tggggctgctggaccaAGGGGTGGAGGCCCTCGCTAGGGCGCTGGAAGTCGATAAGcggctgctgacgctcgacttgcgcaacaacaacattGGACCCGA
GGGCGCCAAAGCGCTCGCGAAAGCTCTCCGAGCCAACCGTACATTGCGTCAATTGGATCTGCGCTGGAATGAGGTTGGGAATCCTGGAGTGTTGGCATTT
CGTGAGGCATTACAGAGCAACCACTCGCTTGTGACGCTGGAACTCATGGGgaacaacagcagcttgaagcacgtggacgagatcgaggtgctgctggcaa
gGAATCGCGCGCTCACGGAGAGACCGCCAGCTCtcgcggtggacgcgtcTTGCCAAAACGACGATGACGTTGGATCGAACAACGACCCCAGAGCTGCTCC
GGATGACCAGCTACTGCTGCAAGTCCTAGCCGAgaaggaagagctggagacggagatgAATCTAGGCAAGCGGGAGCGACAGAAAATGGTAAGGTGGGGA
GCGCAAGTACGTCGTGGTCGTTCTAATGTGCGTTGTATGGTTTATCCAGATAGAGAAGACGGAAGAGCTTGAGCTACAGCTGCAACAAGTTCGCAAGGAG
ACCGGCATGGCAAAGGAAGAACGAGACCgctaccagcagcgcgagatcgaTGCAAAGCGCGACATCCACGAGCTGAGAATGCAgcttgacgagctcgaaA
ACCGTAGGAAGCTGGAGTTTGAAGAGTACCGGTCTGCGCGGACAGCACTCGAGCGCGAGAATGGCGTTACACGAGAGAAGGTGGGGCACATGGAGGCTCT
ACGCAGCAAGGAGGCAGAGCAGAAAGACAAGCACATctcgcagctggaagaggccAAGTATGCGCTCGATAACGAGGCACACCGCACGTTCCTCACGATC
AGGTAAGCCAATGCTTGTTGATCAGCTTTTCGACCACTACTTCGATACTAGGACTTACACGTTAGCTgccgacgtgctgggcaGGACGCAAGAAGAGGAA
ATCAGGAAGCTAcagaagcagcttcaagatGCCCAGCAGGAATATGCCAGAAAAGAAGCCAAGCTGGTGTCGGACCACGAAGGCAAAGTGAGTGCGgccc
agcgacagcatgATATGGTTGCAGGCTCCATGCAGACGCAACTCAGCTACGCCTCCACCCAGCttgaagcgagcgagcggagcGTACGAGAGCTCAAGGA
AAAGTGCGAAGCCCTGCaagccaagctgctgcaggctcaGATCGACCACGAGAAGACCATCGGTGATatcaagcagcagtgggAAACCGAGGTGCAGGAG
CGCATCCAGCGCTCGGTCGGGTCGGTCGAGGCGCAGGTCGCcgaggtgaagaaggcgcggCAACATCTCGAGCGagaggtggagaagcacctCGAGACCA
TCATCCAGCTCCGTCAGGACAAtgtgtcgctgcagcagtcgaggGATGACacgcagagcgagctggaggccgtgaTGGAGACgcaggccaaggcgctgca
ggagaagcagacgcagctggcTGCAGCGGTGAGCGAGCGGTCTCGcttcgaggagaagctgcagctccagctgcggAAGATGGCGGAGCAAGACGCGAGA
CTCGTGCACATGCAGACAAGCTTCGATGAACGGATTCAGGTGCGTCTGCTGTCGGTCTGTAGCTTCCCCGTGGCGTCTTGCCCCCTCACACAGACGACGT
GTGTCCTTTGCCTGTGCTTTACTTGTTTGGATAGGCCCtgaccgccagcgccaagatCGCGGCCGAGGAGAGCGCCACCGTCTTAAAGGAGagggcggcg
ctggtcgcGTCTCTGGAGAGCCAAGTGCTGCGtctggagcgcgagctgttGGCACAGaaccacgagcacgagcagcgcatcgacgacctggccGAATCCT
TTGGCCGTTTCGTGCAGGAGCAAATCGGCAAGGAGCGCGCACGCCGCAAGAAACCGAGttccgacgccgacgcctAATAGCGGCTGCAGTGAAGCGGTGC
AGCGAGATCGG