Description :
From Genome Similarity Track
Location :
Scaffold_22:304711- 306472
Transcript NameFunction/comments
g6074.t1hypothetical protein

Sequence
1761 bases(100 bases per row)
GGCACTGCGAGACTACCGGACGAGGTGATGGTGCCCTTGGTGAAGTCACAGAACCCGGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGTCCGA
CCGAAGACTTGTCGGTCCCTGGGCGTGAGTGGCGAGAATTTAGGCTACCACGACGACAGCCGCCTCTGACTACTCATGACGTGTGGGCCCGCCGGATTGG
AAACTTGGTGCCCACTGTAACGAGGTCTCGACGGGGACAGCCGACGGTGGTGCGACTGACAAATGTGTCACCGAGAATTGCTCACCGCGCGAGACACGAA
TCGGTACTGCTGTGGGTGAAAAAAGGTGACCTGCCACAAGGAGATGGATATACTAGGTTGAATTCCGCCAAGTACGAAGAGTGGCAAGTCCTGGCGTACG
CAGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACAATGGTTGGCAGACCAGCCGCCTGCGGTAGAACGACGAGACTATTCGAC
ACCTCGCGGCATCCTACCTCGACCATCCGGTGACTTGGGAGGCCGAGACGAGGGACAGATAACGTTCGCGGATAGGAGTACTGAGGAACCGACAGAACAA
GACCGAATGCCGTTGACGACCACGATGCAATCCTCTAACGACCCCGCTGGGGGTAGTTGGGTCGGCGAAGATGACGACTCTGTGGCGACCGACACCTCGG
ACAGTGCGGATACCACGTACGCGAGTGAAGAGGAATCCACACCAGTCCTCGGTGATGACGCGGAGACCCAATTGGACTCTGCCTTCGTAGCAATGATGCA
CGATATTACCACGGGAAGCGGTTCAGGTGGTGAGAACGCCGATAACGATACGTCCGAACATTTGGCGAATGAGATCGAGTTGACGGACTATGCGCACGAG
TTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTCCTGGATTATTCTGGACCGAATGTTCTGAACCTGAGCGCGACAGCCCGTCAACAAGAAA
ATCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGCGGGAATGCTCTGCCACCACCAGCCTACGGTGTGGTGTGCGATATTGACGTACA
GGGGCATCCACCCATTAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGCCTAGTG
GCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGATTACAAGCTGGTGAATGCTG
TTACGGCGATTATGGAATACGCCATGCCTTTGGTTGATGACTTGTTGACCGACCTGGAAGCCTACTTATGGTTCTGCTCGCTTGATGCGGCCAGTGGATT
CTGGGCCATTATGATGACGATGCGGGCCCGCAAGGTCTCGGCATTCGTCTGTGCGCTCGGACACTTCGAATGGCTTCGTATGCCGTTTGGATGGAAGAAC
GCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCACTTCTCGGAGCTTATGCGAACGGCCG
AAGCCCACGCCGAGGTTGCACGGACAGGGGTGACCGACCCTTCATCGCGACACCCGAGGAGTCAACAACTCGGCCGACCAAATTCGAGGCCGACCGCGAA
TCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCT