Description :
From Genome Similarity Track
Location :
Scaffold_6:30469- 41877
Transcript NameFunction/comments
Phypl_g265copper-transporting ATPase, putative
Phypl_g266hypothetical protein

Sequence
11408 bases(100 bases per row)
CCGCGACTCCGCAACATATTCCTTAATGTGTTGCGCTATTAGCGCAACTCAATTGGGTTATGTAGCTCTAATCAGGTGCGCAACACACCTGATGCTAGTG
TTGTCGCGCTTGAAGTCGCCTCCCAGAGTCGCAGTCTTCATTGCGCCGCGTGCTGTACCAGCGCCACCTACCAACGCACAAGAGttagagagagagagag
agagaaagcGGACACATGGGCAAACGCAAGGGACGTCGCGCGACCGCGAGCCCAGCGCAGGGCGACCCCGTGACGCTTGAGACGTCGGAGCCTTcgtgcg
gcggcggcgtcaaGAGCGACGGAGGGGAGAccgccgcgtcctgctcTAgtggcgacgaggacgtcaACGTGGCGGAGGCTGAAGGAGGCTGCGCTGACGA
CTGCTGTGCTggcgaagaggaggaggaggcagaGGACGACTGTTGCGCCTCGGAGGCGGCcccaggctgctgctcgtccacggctGAAGAGGAGGTGGCT
GCCAAGGAAGAGCCCGGGAAaactggctgctgctcgccgaaGCCGTCGGAGGATGAGACGGAAACAGAGCGGGCTTGTACGAGTAAGAACGAGCCCaaga
cgtcgagctgctgctcgtcaaaGAAGTCGCAGGCCACTAGCAgctccggctgctgctcgtcaaaGGGCCTGGAGGTTGCAGTCGAGCCTGACGCTTGCTG
CACatcgaaggagaaggcgtCGACTGGATGCTGCTCGAAGGAGCCGAAGGTTGAGGTTGAAGCTGATGGCTGCTGTGCCTCCAAGAAGGAGCCGGAGCAG
TCGgggtgctgctcatcgaAAGCTCAGGATCCGCCACTTCCGGAGAGATCTCCCAGCTTTTTGACGCGGTTGACGCAGTTCCGTGGCGATCGTGGAGCCA
CCctcgagaagcagcggaCGCGCTTGGACAGCTCAggaaggaagaggaagacgactGGGTCCCTGGAGATCCTCCGCTTGAACATCGGTGGCATGACATG
CAGCGGCTGCTGTACGCGTATCGAAAAGTTCATGAATACGCAGCGTGGTGTCGCGGACGTCAACGTGAGTCTGCTTACGAGTCGCGGCATCTTCCAGTTC
GACCCGGAGTTAGTGACAGCGAAGCACATCGAGGAGACAGTGGCCACCTTGGGGTTTGAGCCCAGTGTGCTTTCCAGTGACGAACTGGTGAGTGTCGTCC
TGCACCTCGGTCAGTCCGGAAGCTCCCGTCGAGCCAAGAAGTTGGCACTTGAGGTCGCTGGTGTCGTCTCAGCTGAAGATGTCGATGAACCGGTCGTATC
CTCGACTTCATCGGGCAAGGCATTGCTAGTGGAGTACAACCCAGACATGACAGGCGCCCGTACGATTGTTCGTCAACTATCGCGCGAGCTAGGCTTCACC
GTCCAAGCGTCGACTCCGCGCGCACCATCAGTTCGTGCTGGCGAGGAAGAAGTGCGACGCTTTACTCGACTCTTGTTTTGGAGTTGCTTGCTGTCACTGC
CGGTAATCTTCGTAGAGTTCGTGCTACCGGCGTTCTTTCCCTCCTCCGGCAGTAATCCAGCAGATACGGCTGTATGGGGAACCGCGAACCGCTTGAGTAT
CCGAAATGGTGTGGAATTGGCGTGCGCAACGCCTGTGCTATTCATCGTGGCGCGGCCCATTCACGAGAGCGCATTCCTCGCGCTACGTTACGGCGGGCGT
GTTACCATGGACGTTCTCATCTCGCTCAGTGCCTGCACGGCCTACGCGTTTTCCGTTTTCACTGTTGTAACTGGAGCGCTCGCAAAGTCGCAACCACAAG
TGGAGACGCCAGCCAAAGCTGAGACCTTTTTCCAGGTCACGGTACTGCTTGTTACTCTCATTCTCGTCGGCCGCTACATCGAAACACTGGTGAAAGCCCG
TGCCTCGAACAGCGTGGACGCATTACTGCGCATGCAAGCCAAAACAGCCATTTTACTCGAAGAGGGCCAGAAAGAGTTGTACATtgacgtggtgctcgtg
gagcGAGGTGATATGCTAAAGGTACTTCCGGGTACGCGAGTGCCTACGGACGGCGTGGTTGTCGGAGGTGCTAGTTCCGTGGATGAGTCGATGGTGACGG
GTGAAGCTCGGAAGGTGCCCAAGGAGACTGGAGCGATTGTGATCGGTGGATCCATAAATGCGCAAGGCGTTCTGACCATGCGAGTAACTCACACCATTCA
CGAATCCATGCTGGCACGCATGGTGAGACTCGTAGGAGAGGCTCAGGCTTCTCGCGGAGTGCGCCAGAGCGTTGCGGATGGTGTGGCTGCATACTTTACA
ACGTTCATCGTCATTCTGGCCGGCTTGATGTTCATGCTCTGGTACTCGCTCGCTAAACACGGTCAAGTGGATACGCAGGGCTGGGCTCCTTTCCCGTTCG
CGCTGCGCTTTGCGATTACGGTGCTAGTCATTAGTTGCCCATGCGCAATTAGCCTTGCCGTGCCAACTGCTGTGATGGTGTCGACGACAAAAGGTTCCCA
GGTGGGTATACTTTTCAAGGGGGGTCGCGccctcgaggcgctcgaggaagtGGATGTTGTCGTGTTTGACAAGACGGGTACGCTCACCACTGCGCAGCTT
GGAGTTGCTGGGGTCTTCACGCCACAAAATGACGTCAATAAGGCACAGCACTGGCGCTgcgtagctgcagcagagaGGGACAGTGAGCACTCCATTGGAA
AAGCGGTCGTGGCGCACGCTAAgacgcagctccaagatTCCCAAGTCGAAGATGCGCAGGGATTTGAAGCAGTTCCAGGATGCGGTGTCCACTGCACTGT
GCTTGGTGTTGATGTGCGACTTGGTTCTCTCACCTGGCTTAAGCAGCAGACGTACGGTGACTGTTGCGCTCTTAGGATTCCTCCTGAGTTTGTCGAAGCA
AACCAACATTTCCAGTCCCAAGGCAGTATTGTGGTGTTCGTTGTCATTGATGGCGAGTTGGTATCTGCAATTGCGCTGCGAGATGCACCGCGCCCGGAAG
CCAAGCGTGTCATCGAGCAGCTGAAGCGCGAGGGGATTCAGCCGTGGATTGTTACCGGCGACCAGCGCGGCACGGCCATGACTGTAGCGACAGCACTCGG
CGTGCCTGAAGGCTCTGTGCTGGCTGAATGCCTGCCTCATCAAAAAGTAGACAAGGTTCGCCTTCTGCAGAGTTTGGGTCTGCGTGTTGCTTTTGTCGGA
GATGGTGTGAACGACGCGCCCGCACTAGCAACGGCTGATGTTGGTGTTGCActtggagctggaactgACGTGGCGatcgacgccgccgacgttgTGCTGG
TAAAGGATGACCTACGTGATCTACTCAACGCCCGCGCGCTTTCGAACGCCACCAACAGACGTATCAAGCTTAACTTTGCTTGGGGGTTCATGTACAATCT
GCTCATGATGCCTATTGCGTGTGGCGCGTTGTACGCTCCGTTCGGGATTTGGATCCCTCCGGCCCTAGCTGGTCTGTCGGAACTACTATCGTCCGTCCCT
GTGATCCTCCTCTCACTGCTGCTTAACTTTTGGAAGCCTCCGTTCGGTGGTGACTGGGGTCTCCTGCAGAAGCACGTGGCAATCGACGTGACGGAGTCGA
CGCctctgctgcagaagcagcactaATGTGCTGGGGAATGCCGAACCGACAAGCCCTAGGTAGAATATCTTGCTGAGAATCAACAGGTTTGTTATTGCTT
ATGGCGAAGATTTGTTCTTTATCGTGCTTTGTGTTCCTACTAGCTAGGAGTAGAAGTCTTCGTGTATTCGAGGAATGCTGCTCTCGCGTGCGTTCGTGTT
GCGTGTGGGTCCACTGACAGTGTCGTatcgccaccagcgctgcCGGAGACAATAGCATCGAATCGgcgatgaagcagctcgatATCTTCACCAACAGGTA
CTGCGAGATCACAGCTTTCGTTTTCGTTGTCAGCCGCACGCATGCTGCGAGCGACCATAGCGCCTGACCCGCAGGATGGATGTGCCGGTGTGGAGGCAGT
CTTGAGCTTTTCTCCCAGCCGACAGTCGTTCACAAAGGCATCGCGCCTGGCAATAGCCTCCTGCTCAGCTTGGTCCTCGCGCCGTTCCTGCCGttgcttc
tgctcctcgtctGGTTCGTCTCGTGCAGAGCGTGGATCAGGCGTCATCTTTAACTGGTAGCGTCGCTGGAGCGCCTTGAGCGAGAGAGCAAGATAGACAC
AAGCTGAGGCACGTGTCGACATCTGCGGAAATTTGGGGCGTTCGCTGCCCAGTGCTAGCAGCACTTCGTTTAGcgcagctccaagctgctgctccaactG
GCCCGGATAGCTCTTGGATAGTGTCACCTGGGGTGGCAACTTCATTGGCAAGCTCTGTGAGGTGTATCGAGATGGTTCGACGCAGAACTGACGGCGTGCT
TcctcggagacgaagaagTAAACTTTCGAGCGGTACGATGCGCGGAAGAAGACACTGCCATGGCGAAGTGCAGCCCAATCTTTGGCACCAGATCCCGATG
CGAAAGTGACCGGGCAGTAGCCTTTCATCTCGGGGAAGTCGCAGTCCGGCACCGTCAGCAAGCTCACGAGTGAAGCATTTACTGGAGCTCGAGCCACAAG
TGTCTGTGCCTCGCActccgcttcttcttgtgtCGGCCACGGTTCGTCTCCCCCCTGCACTGGAGTTTCATCGGGCAAGTATCCGACGAAAGCCTCAGGA
TTCTCCACAAAGTGCTGTAGACTTCGTTCATTCCCAaaccagaagctggagtcCCGGAAGTCTACGCACAGGTCACGGTTGGATTCGCGCGAGTTGTAAA
ATTTTCCGGCGTGCAGGTCGACAGGACAAAACGTCTGAAAAATAGGGTGCTGGCGCGCTTGTAGCTCTTCACGGGAACGCACCACACCTAGTGAGCGGGC
AGCTCGGTTGCAAGCCATTGCTCTGGTATATTGCGAGgccaactgctgctgctctttgAGGAACGCCTGTGCCTGGGCAGCTACATGCCAGAGCGAGTTG
CTCGAAATGTCAAGTTGCCGCACGTGGAATATGCCAAAGCGTCGAGTCCAAGtgtcaagcagctccagccggAAATGGTGCCATCGTGCAAATGCTGCCC
GAAGCTCGTTTCGCTCTACGTGAGTTTGATGATCCGTCCAGACACTGGCGAAGTCGCGCTCCAAGGCGAAGAGCATGTCAGGCCGGATACTCTGCGAGAC
AAGCTCCGTTGTGCTGGAGTTTGATAGACTGCGTTGTAactcgtggcgctgcaacAAATATCCGTCAAGAGCCCAACCACGTGCCTGACACTCGGAGGAG
CGCAGACGAGCACAAATCGCCTCATGAGTGACGTCTGCGCTGGCTAGCggatcctgctgctgctgcgtgatCTCCAGCAATCGACACCGCAGTGTGGAGC
CACCCTGACACTGTATCACCCATTCAAGTGCAGTTTTGGGGGATACGTAGACCAGTCCGAGCGCAATCGCGAGCTCCTGAGCCACGCGGGTCTTGCCTGA
AAGTGGAGGACCTACTACACAACAGGTCGGCGGATGCTTAGGTGGTTGACTTGCTTTGTCCAAGTATATTGAGGGACAAGACACAAAGGCACGTCGGGCT
TCACGCGATCGAGGGAAGTAAAGCTGGTTCCGATGAACAACTGCTTTCATCGAGCTAGCCGATACGGAATCCGTACGCCCAGTAACGGGGCAGACAAGTC
CGTGTTTGCCTACAAACAGCTCTCCCGACGCTAGCATCTGATGCATTTTGCCCCCCGTCGTCATGTCAAGAACTTCGCAGCGTTCGAATAGCGTATCCCG
TCCTGCCATAAATTCATCAAGGATCCGCCTCACGTGCTTGACCATTTGTCGTGGTGCACTGGTCGCATCCACCGGGTCGCAGACTCGGATACCTCGTGCT
CGAAGCCCAGTCACAGCCTCATCCAGAGCTTTCTGGTCCTCTGCAAACTGTTCGCGCAGTCGAGTACTCTCTTCTTCACGCACTGCTTCCAAGTCGATGg
gctcttcttcttcagcgtcttctggAAGGGTGCCATCGTCGTCCGCCTCTCCATCTAACTCCTTTTTCCGCATGAGAGCGAGCTttcgacgaggtgctgg
taGGTTGGCAGTCCATCGAGCAAGCAAAGTGTTGGAAACCATATCTTCCGACACCGTCAAAGGAACCACAAGAGCTGGAAAGAGTCCATTCTTGAAACAC
ATTTCCAGAGTCACTGCATTTGGGATGCGTGAAGCTTCCGGTCCCAACCCAGCAACAATTTGTGCTACAGCCCTTTGGTGAGTTGCGGGATGGCGTTGCA
GTTCtagttgaagcgctcggaCAAAGATTTCTTCGGCCGTCAAGCGTGCATCTTCCGGTTTGAGCTCTTCTAGAAGTTGGTTGCGTTCCACGGCCTTCGC
AACTGTGGGCATGTCCACATTCACGTACTCTGCGGGAGAATCGATTTGCTCCACTTGTGGCtgagcaagtgctgcagcgattCGACCCCGTCCAGAACCT
CGAACACCAAGTATCAAAACGCAAGGCACGAAGTTCGTAGTTGCGCAAGGGCCGTTGGGGATGAAGGCGGCTGGATTTCGCTCGAAGGTACGCCGCTCAG
ATTCACCAGCGAAGGCGTAAAACTTCTGACGGAAAGAACAAACACTTGATGGCTGTCCAGGTATCAACAAGCCACGCGTACGCCAAGACACGGGACAAAA
GCGTCCACACTCCCCTTGAAGCTGTAGCGCTctgtttcttgctgcttcagcttgcgcttcaacCTCAGGGTCTGAGACCTCGACctcaccttctccttcc
tctGGTGCCGATTTTTGTTTGTTCTGGTTCTCTTCATCCTTTTCGGGAACTGGTGGGGCGAATATCACGGCTGGATCGTATTCATCAACAAGCTTTGGGG
AATGTCCGTCTTCGATGCTGTCCAAGCGTGGGGCAATGGGGTTAAGCTCGCGTTCGATAGCTGCAAGCGTATCGCCCGGTTGGCGGAAGAGTGGGCACGT
TATGACTCGAGGCGCGCTACCAAGTCCTTGTGAGATGTCATCGGCACCAGCTTTCTCAGCCTGGAACTGCTGACGTCGCAGCACGGATAGAGCGCTAACA
GCTTCGATGCTCGttcctccttcctcttcttgagcagcggcgaccTCCCTATCCATCAGCAAAATTGCGTCGGGCACACACCCGTGCTCAAGTAAAACAG
CGGCAACATCGCGTGTGAGAGGCAGATCCGTGATCATCCACCCTGCCGGCGTGCTCGACTTGGCCAACAAGGCCttggcggcttcggcggccaccgttgc
agcttcaacagGGGAGACAATCTGTCCGCCCATGAGGCGCATTTCCGTTGAAATGCTTGGTGAATTCTTGAGCAACTTCGAAGGTGACACCGTCTGCACA
TAAAGCCCAGCttcgagcgtctccagaTACGAAGGTGTGAAGACTTCACCTGCGCCTGTGGTGACGAGCCAGAAGTTTCGATACGTGGATGGAACCGGGA
TATCCCGACGCAAATACTGCAACGGGTGTGCACAGAAGTCGCGTCGTGCGGCTTGTGATGTCAAAAGGTAGACCCGACCGGAGTAACCTGCAGCAAACTC
CGGCTCGCCAAGCCTCAGCGTGTTGGTAAAAGTCGACAGCACGGGACAAAACTCACGCCATTTCGATAGCTGTCGGCGTTTAGCATCGCGTTTAGGAAGT
CGTGCAAACGTCTCACTTGCTTCCGCTTCTAGAAGTGCACTCCAATCCCCATAGAGCAGCCAACGAACTTTCTCGCCGCGGCTAGAACTGTTCAGATCCT
CTGGCAGGGATATCGGACAAGCTTCGCGCGAGATGCTGCACCGCGACAAACCGAGTGAAGTCTAACAAATTTCATAAAGTCAAGACCACAAAAATCACGA
GCCACTTGAGTGTCAAGCAGAAACAATCGTCTAGTGTCAGCAGAGCTACGTACGCCTGTGATCGCCTGGATGCAGTGATCTCGGATTACATTGAGAGATT
GCGTGGCCAAGACCACCACCAAGTGATAGTTCGACTGGTTGCCccctgcgtctgcagctcggcgcgctgAGAGCTCACGTTGCATTCGCGTCACGAATTC
GTGGAATCCCTTGGCGAGTTTTACCGCAGCCATGGATCCGAACGGTAACGTGGGCTCTGTAGGCGGCTCGATCTCGTTGCGTTCTGCAGGAGTCGGTTCT
GTTGGTGGTACAGGAGGTCCTTCCGGTGCATCTTGGCCGCTGTCTCCGTATCCGTCCTGGTCATTTTCTTCGGGCGAAGACTCCTCGACTTCTTGGCCCT
CGTTGTGTGGGCCAGCCTCGCCGTTTTCAGCAATAGTGGCGGGCTCTGGCAACACCTCAGCTTCTGCCTCCGGTTTCTTCGGTGGCAAGAGAAAATCTCC
GAAGCCTGTGGCAGCCAACTCCTCGCTGCTTGTCATCTTCAAAGTGGCAAGCTCTCGTACTGAGTACAAACGACCTGCTACTGGCGCCAACTCCGAGTCT
TTGAACTGGTACTCAATCTCACTGGGTAATGCTGTGAGAGCTATCAAATAGTCTGCCGCTATAGTGCGTTTGGGGTTATCTGAAGCTGACAGCTCACTCG
GGTACACGTCATCCAGGACCACCCCAACGCCAGCTACAACAAACAAACCAGAAGTGAGTATTATTATTCATTGCTGCGATGATACACCAACGTACCGAGC
AGGGAACGCGTGGCTTCTATTCGCAGTACAGCAAGAGCTGATTCTCGTGGAAAAACGTTTCCTGTCCAAAGCGCATCGAGATGTTCATCCCGAAAAACCC
GATCCATTTCTTCATCCGCATCGTCAGTCTCGACTTGTTCGGCTTCATGCGTTGTCTCTGCTAGTGGCGGTGTTTCCGCACttggttcttctccttctgc
aggtgcagcagcagcagttcggCGTCGGCGCAATCGGAGCTTACGGTCGACCGCACGCTGTACAGCTCCATCAAGTGACAAATACTTCAGTCCAAGTCGT
CGTGCTAGAACACGAGCAAGCCGCGTCTTGCCGCATCCAGGTGGCCCAACAACTGCGACTCTCAGAGCAGGACAGTCGGTAAGCGCAGCGGTGAGTGCAT
CTTCCGGATTCCAGTGCGCTGCGGTCTCACGGTGAAGTTGTCTAACCCGAACGGGGGTCGCTCCTGAGCCAATAGAGcccatgagctccacgtGCAAGCG
TCGTGCAATCTCCATGTCGTCTTCAACGTCAGGTTTGGGCGTATCCGTCTTGGCTTCCTCTGCTACATTTGCTGTGGCATCAGCATTGGCCATTTTCGTG
GGAAATGCACGCGTGAGCGAGAATTTCCGCGGGTTGTAGCtgacaagaagctgcttgagcgACATCTCACGTTGGTCAGGCGGTTGCAGTCCCCGGATAC
TTCGCATGGCAGCACTTGATGGTGGAACCTTTTGCAGGAACGCGTCGTTGGCAATTTTCGGGATTCGCTTCAGTGGTCTCAACGTGAAGCGGCCCCCTGG
ATCAGCCGAATTGGCCTCATCCTGCTCCggtttgctgctggaaggagaGACGACAAGCTCCGCGACGGAGTTGCGTAGCTCCCGGAAGAACGTTAAGTAA
ACGCCTGCTGCACTCTCCACGGGAAGAATCATTTCTGCGAGCTGCATGACAGCTTCACGAAATTGTTCTGGTGTCATAACTTCGTTGTGCAGACTTGACG
GTGCTTTGGTGGTAGGATCACCGATaccaccagcgccttctAAATCGTATTCCCAGTCACGTTGTGCCGCGGCAATGGCAAGTGCATCACttgacagcgg
cagcaccagcgcttTAGCGGCTCGAGCGAAAAACGCGACGTATCCGTCTCGACTCAAAGTGCAGGAAGTCATGAGTTTGGCCAAATCCCAGAGCAGCGTC
AATTCTCGGGCTACCAACGCATTTGCTTCCCCCCCGCTGGCACATTCGTCACCTTCCAGCATGGCATTTCGACGATTGTGCCATAGTCGAAGCAGGTTGG
CCTTGCCCTCGCCGACACTGCGTTCCTTTTCGTCCTCAGCGAAGAGGAAATGCCGACGCATCGGGAACTCGAAGGCGTTCTTGATGTCACCAAGCTGTGA
GGTGGGGAATCCACTGCAATGGAGTGCTCTAGCGACGCGTCGGACTTGGAAGAAGACGACTGAAGGCAAAAGTGGTTGGTTTCGTTTTTTGTATTCCCGT
TTTTAGTTGGGGGTTCTACACTCGCTGGGAGTGCTAATAAGCGTGTCTTGAGTAGACACGAGTTGGAATGTTTTTAGTAGGCTCTAAGCTAGACTTCGGG
ATGTGAGGGTGACACGAGTCGAGTCGAGTGCAATTTCTGCACTGCCGGTGCGAAcgcgcgtcttcttctcgctcggACGCTGGTGTTTCTTCATCAACTc
ctcgcccttcttcttgatcatGCTGCCAATGGACTTTCGTCTAGACTGCTTGATAGTTGTGATCTCCTGCACCCAcgggtgctgcagcgctgccgtcACT
GAAAGTCTCGATTCGGGGTTCACATCGAGGAGACCAGCGAGTAGGTCGACGCACGAGGCTGGCACCTGCGAGAGGAGTCCGGTCTCCTGGAGCGCAGCGG
CCGTGCCGCGTTCGACCATTCGACTGAAGAGCTGGTCACTGTCGGTCGAGGCACTGCGTACCAAAGCACGCTTGGTGCACAGCGTCCACAGAATGACACC
GAGCGACCAGGCATCGGCGCGACGTGCATCTTCCACCTCAGTGTCACGTAGCAGCTCTGGCGCAGCATAGGCCTGCTTGGCGACTTGTACGACCTGAACA
CTCGGTCGGTCGTGCTCGAATCGCTGGGCGTGGCCCAGGTCGCCCACCTTGACGACGCCGGATTCCGTGACGAAAACGTTCTCGGGGGATAAGTCCAAGT
GGGCGATTCCGGCGGAGTGTAGCGCCTGAACGCCTCGCAGCACAGCGGTAAACACACGACGTCGGCCAGCATCGGTGCATGTCATCATCAAAGAGCTCTG
AGGCGGCACGCCGGCCGTTTGAAGTCGACGTTCCTGTTGCATGATTTCCAGCAGGTCTCCACGAGCGCAATGCTCGTGGAAAAGGTGGAGTCTCTCCCCT
TGCAGCGAATGACGTTCCATCTTGACGACGTTCTCGGCATCCCGAACCGAGAGGTGCAGATCCAGTTCGTGCAGCGCAGCGGCACTTGCGCTGCGACCTT
CAGGGGCGGACGAGGTCATGAGAGTATACTTGTCGATGAACAGTCGACCGGAGGCGGAGCACTCCACCAGATCCACACACCGAAGACCATCGAGACTCTC
CTGTATACGCGAGCGCAGCTTTAATGGAGCTTCCAGGACGGGAGCCATGCTATATATTCTAGTATGTAGAGAGAACTTtgccaccttgacggcgTGTTGG
AAAGTGAG