Description :
From Genome Similarity Track
Location :
contig_1:304666- 306228
Transcript NameFunction/comments
g85.t1hypothetical protein PHYSODRAFT_302978

Sequence
1562 bases(100 bases per row)
CACCCAAAGCTCGAACGTTCCCTTGAATTTCATCAGCAATACTACGTCGCTCTCGATGAGGCTAGCGAGTTTCGGGCACAGCCGACGACAGATAGTGAAG
ACAGTACGTGCGATGATCCCGACGTACTAGATAGTCACTTTGAGCGTGCCAGTGGCGCTGCAGCTGCACGAAGCGAAAATCTGTTGGCAGTTGGATCAGA
CGTCTACACTGCCGTCACCAACCCGATCAACATAACGGACGAAGAAGCAGCTTTATTGCAGAACGCTGCCGAAGAGAGCGCCGTGAAAAGACTGCTGAGT
AACGTTGAGCTCACTGATCTGCCAGCCGATCAGATTTCTGACGTATTCGTGCGCTCAGTACCAGTCAGAATGAGCGAGTTGGAGTCCTTCGAACAACAAC
TAGCAGCCAAGCATCCGCCGGAACGCAGCTCGACCAACAACAACGACTTCGTCCAGACGACCGAATTACCGTGGAGTTACTCAACGCTGCCGTCGCTGAC
TTGACGATCGCCGAAACTAACTCCTTGTCAATCGACAACCTAACGCCGTTTGCTTCGGTGCAGAGCGTGTCCAGCGCGTTTAACCTCAACAAAGAGCAAC
ACCTCGCATTTTGCACGTTGCGGTGCCGCTCCTGTACAGAATCGCCGACATCAAGATGCTGCCGCAGTCGACTTTCTGTGGTGATCCATTAATAATAACG
GGAGCAGGAGGCACCGGGAAAACGCGTATTGTTGATGCATTGCGATGCCTCGCATGCAATTGGGGACGGCCGAAATGTATCATGGCAACGGCGTCAAGCG
GAATTGCAGCTGCAAACCTGAAGGGGCATACCATTCACAGCGCCGTTAACCTCGGTATCAACCAAAAGTGCCTGCCACGTCACATCCAAAAACCGGGTGA
TAAGTTGCGCACCAAATGGGATCCCGTATTGTGCGTGGTTGCCGACGAGATGTCAATGACAGACGTCGGCTTTTTTGGCCTTTGGGAAGAAGCGCTACAG
AAAGTCAAAGACTGCCGCCAGCCGTTCGGCGGGCTGCTTGGAGTATTCATGTTTGACTTCTTCCAGTTACTCACAGTACGTGGAATCCCGGCCTTCAGAG
TAGCAGACTCACAAAAGCCATACAGCGAAATCCAGGCACGGGGGTCATTGCTGTACAGATCGGTCAACAAAGTCGTCTACCTAACGCAAAACATGCGCTT
CGCGAGTGACCCGGAATGAGGTGAATGGCTCGCACAAGCGAGGGAAGGTAACTGGGTGCCGGAGCTGCGCGAATTTCTCGGGAAGGCCGAACCCTACCAG
CTGACGATCTGCATGGCCAGTTTATCCAGGTCGTCTCGACCGACAACGCGTACCGCAAACGAATCAATGACGCCGCAATCCAGATTGCCTGCCGTGCATT
AGCCCCGGAACGCAAAGTGTATGCTGTGCCGGCACAACTACCAGCGACACTAACGCCTGCGAAAATTGCACAGATCGCCGACTTAGCAGACAGTCAAACC
GGCAACATTCCAGTCTTTCTAAAAGCTTACATTGGTAACTGCACTTCTCGTCTACAAGAAAA