Description :
From Genome Similarity Track
Location :
scaffold_5:304606- 306477
Transcript NameFunction/comments
g8156.t1 hypothetical protein PHYSODRAFT_353776
g8157.t1hypothetical protein

Sequence
1871 bases(100 bases per row)
AGCGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGGCGGAACGACGAGCCGATGATCTTGTTGGCACGGTGGCCACGCTTGCGGAGGCC
ACGGCCCTGGCGGCCGGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGTGCACGGCGTTGGCGATCCAGTTGATGCGCGGGTCGCGACGGATGACCTTG
TGCGAGTGGTCGACCATGATGATCTCGAAATACTTGTACGTAGCGTCCTGGTTCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGG
CACGCTCCTCAGCCACCGAACGCAGGTTGCGCTCGAACTTGAGCTCGTTGATACCGTGGTGCTTGGGCTTTCCGTACACGATACCCTTCGAGTTCGGGCG
CTTGCGGCCACCGCGACGCACGGCGACGCGCACAATGACGAAGCCCTGCTTGGCCTTGTAACCAAGGCGGCGAGCCTTGTCCACGCGGGTGGGGCCCGTC
ACGCGGTGGATGACCGGCAGCTGGCGGTACTCCCAGGCGCGCACACGCAGCAGGAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGT
ACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAAGGAAATGCTCCGACATATTGGGCCACCAGGCCAGGAACGTGCCAGCCCCAGCCAGTCATTCAC
ACCAACGGTCCCGCTAAGTACGACCGAGGTTAAAATGGGATGAGTCAATAAAACCTTGTTCGTATTTAAACAGGATGTTTCGTGTACCCCACACTACGAC
TGCTTGAAGTTGGCGCTCCGGATATTCGTTGTCGTCTTCATGGTGTTCACGACGATGCTGTTGCGCACTACCGCAGCTCTGCAGCAGACCGGCGGCCGCT
GGATGAGCGCGGCGGCTACGACGGCCACGCAATTCAAGCTGGAGATGCTGGGCGGCAAGGACGCGGGCATCGCGCTCTTCACCATGGACCGCCCCGAGAC
GCGCAACGCTCTCGGCCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGGACCAGGTACGCTACGACCCCAAGGTCCGCGTGGTAATCGTGCGCAGTGTT
GTGCCCAAAGTCTTTTGCGCCGGTGCAGATCTGAAGGAGCGTCTAGGCATGTCGCCTCCGGAGGTACGACGACTCTATAGCTTGCGCATGCAGGGAGGTG
TTGACTGGGGCGTGATACTGCAGGCTGCCGCTTCCTCCCGTGGCTATCGCACGGGATTCACCGACTTGGAGCAACTTCCGATGCCGACGATCGCCGCTAT
TGAAGGAGCTGCACTTGGCGGTGGCATGGAGATGGCGCTGGCGTGCGATCTCCGCATCGCTGGCGCTAAAGCCATCCTTGGGTTTCCAGAGACGTCTCTG
GCCATTCTACCTGGAGCAGGAGGCACCCAACGCGCGTCTCGCCTCATTGGTATGGCCACCAACTTTTTGTCGTCCTTGCTCTTAATTGTTGTACATGTAC
TCATCGTATCATCCTCGCTCTTGCCCCGCAGGCATCTCGAAGGCCAAGGAGCTCATCTTTACGAGCCGCCGCCTCAACTCGGAGGCTGCTGAGAAGGTCG
GTTTGGCCGACTACGCCGTGCCTGAAGGTAAGGCCTACGACAAGGCGCTCGAGATCGCGCGTGAGATTCTCCCCAACGGACCTGTCGGCGTCCGCATGGC
CAAGGAGGCGATCATGAGGGGCTCTGAAGTGGACATTGCTACGGGTATGGCTATCGAGAACGCTTGCTACGCGCAGGTGATCCCGACCAAGGACCGCATC
GAAGGTCTCGTCGCTTTCAAGGAGAAACGTAAGCCGCAGTACAAGGGCGAGTAAGGCCGATCCGTCGCCTT