Description :
From Genome Similarity Track
Location :
Scaffold_229:30452- 34586
Sequence
4134 bases(100 bases per row)
CCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAG
TACCAACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGC
TCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGTCCGGTTTGACGCGCTCCA
TGTACAACCACGCCCGGCTCCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGAGGGTTTGCCGAGTG
TTCGTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCTCGTCGCTCCTTTTCTACAGCCTGATAATCT
TTGGCCATAGTGAGGGCGACCTCATTTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGCCCTTGTTTGAGTGATGACGACA
TTGCCCGCAGCGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTCTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTT
CTCCGCGATTTCGTCCCAATCTTGCTTCTGGGAGATGTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAACGTTCCTGCTGTCCATTAGCC
TGTGGCCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTA
TTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCC
CGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCA
GCTAGCACGTTACCAGGTGAGTATCCACGAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACA
AGCCATTCCAATAATAATCGGACTTAACGCGTTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAATTCTGCAAGACCTCTTG
AATCATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCA
GACAATACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACC
TCTGCTCCTCGTCTTGTGCCACCTGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGT
CTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCTCCGAG
TGTTCATCTGCAAACCTGACTCGTTTCTTAGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTAAGCTGTAATCAACCA
CGAAATTTTCTTTGGTAAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAATACATGTACTTGACGCTCTGCT
CCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGA
TTACTCGACTGACCTTAGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTT
GGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTATAGATTGTTGAATCGCGAGCCTTGAGTCACCA
ACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACGCCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAG
CGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTTGCTGATCCGTCAAA
AGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAGCGCGGGGTCTATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGC
GCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCC
ACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGT
CTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTTAAGCACC
CGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTT
TCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAA
GTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCC
TTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCT
TGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAATCTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATC
CTCGCCACCGAAGCAAATGTCATCCACAAACGATCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACG
GGGCTGTTGACGAGTTGTAGTACAGGGTCGGTTTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGAC
GTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTTCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACG
CTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGTAAG
GTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCAT
ACTCCATGATCGCGGTGATAGCATTTACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCGTTTTCATCACAATCACGATCGGCGATGCCCA
TGGACAGTCTATAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGT
TTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCACCGTAGGCTGGCAGCGGTAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCT
TTAGCGTCGCGACCAGACGTTCTCGGCGTTCAGC