Description :
From Genome Similarity Track
Location :
Scaffold_906:3045- 5143
Sequence
2098 bases(100 bases per row)
AACTAAGTTACCCGCTTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCCTCTGGGCGCTGCCACCATCAAAGCAACCTTGGAGTCGTCATATACGTCG
ATGACATCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAACCCTTGCGGGCGCCCCGGGTCCTGACAGAGGTGGGGACATGACTCACCAATGCTCTGT
CGGACTGCGCAGGCCGGCTGGCACCGATTGCCTTGTCTCGCCAGTCGATCCAGAGCTCGTGCTTCTCAAGCCAGGGTATGCCCAGGATCATATCATATGG
ATCCATGTCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCTTTT
GGCCAGTCGCACTGACGCCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCGGACAACTTGTTGCTATTACGAGCAACTGTCTGGCGGCGTGCGAAATTC
TTCGACGCCCCAGAATCGATCAAAATTCTAAAGGGATGATTTTGCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGAT
TCGAGAGTGTGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCC
CTACTGGTTTCCGGCGTTCCCCTGTCCCCGGGGTCCTGGCTTCTGCCAGCAACCCTTGAGGACGGGCTTGGGGAAAGACCGTCTGCGGAGTATTTTCGCG
GGACAGTCGCGCTTGAAGTGGTCCATCTTCCCGCAGCCGAAGCAGCAGATGTCACGCTGTTCGGCGGACCCGTGTTCCATGGGAACTGGTCCGTTGGGGC
TCGGATGACCGGGAGTCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGTCTGGCGATGGGTGTACTCTTCCTGAAGAGCCACTTGAATCGC
CTCCTCAGGGTGTTTGACTGCACCCGGAACAGCTGAGTGCGCACGGGGCCCACTCGAAAGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTCGAGTG
GGGTTTTCACTAGGGACGCCGTGAGTTCCCGTATCTCTTGCACGTACTCGTGCAGCTCACGCCTCCCTTCCTTGCACGAGAGGAAGCGCGAACGCTGGCG
GTACTTGTAGTTCGCCGGAAGGAACGCGGCTCGGAGCTGTTCACACAGCTGAGCCCAGGATATGAAACATTCAGGGGATGTTGCTTCCCGAGTGTACACC
CAACTCTTAGCACGACCGCTAAAATTGGAAAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTATCGGA
CCCAGAAGTGAAGCTTCTCGCCTTCCTTCCCTTCATACGGCCTAACCCTTCAGCATATTGGCTTCGGGTGTGGCGAATTTGCTTCCGCTGCCGGAGCCTG
CAGGTTCTCTCGCGCATGCGCGATGCGCCCCTGCTCGTACGCGTCAAAAGCATTGACGCGCTCGATCTGCTCGGCCGGTGTTGACACAACCAGGCTCTGC
AGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATAGGAGAAGTCGTTCCTCTCCATGGCAACGAACTTCG
GAGAGGTTCAGGTAGTCTACTCGCGGTGGCGTGGATTGCTTACGAGTGCTACCAAGTATGACGGGCCTTGCGCTAGAGGAAGTTAGCTTCCGAGAGTATA
CAAACTCTCAGTGAGCGGCAGTTCACAGGTCCCCTCTTTATCAAAAGAGAGCGAAGTGACCTATTTAAGGTAGAACTAGCCGAGCGCCGCCGCGTAGCGG
CGGTACTTTAGGTTTAGCTCTACTTGCCTTGGCCTTGCCGCCTCCGCTTCGCTTCGGCGGGAAAATTATTTAAAAAAATATGAACCCCTATGTACTTCAT
GAATTTCATAATTCTGGGTTTAATTTAGACCAGTCGCTACAAAATGCTGAGCTCCCAGTAAGCCGTGCAATTATTTCTACAAAATGCATCACACTTAC