Description :
From Genome Similarity Track
Location :
Scaffold_1:304427- 321636
Transcript NameFunction/comments
Phyta_totarag96hypothetical protein
Phyta_totarag97hypothetical protein
Phyta_totarag98hypothetical protein PHYSODRAFT_349437
Phyta_totarag99pyruvate dehydrogenase [lipoamide]
Phyta_totarag100conserved hypothetical protein
Phyta_totarag101hypothetical protein PHYSODRAFT_469105

Sequence
17209 bases(100 bases per row)
GTTTATTGTGGAGCTTATGGAGAGCGCGATGCCGTTGAGACAGGCTTTCCAGGAGGTTGCGGATGCTCTGTCGATCTCGGGTCGAGATGTTTGCGTGGCA
GTGTGGCCTACCACAGCGACGGGTTGtttcgtggacgagttccAAGTGTTGACGGAGCGAGAGTGGCAGCGACTGCTTCGAGTTGGACTGCGACTCACTC
CAGCCGCCGATGTGAAAGAACTCTACTGCTTCCGGAACGTTCTGGCGTACAACGGATTGACGGTGCGCGTGCTGCGACTGGTTCAAGAGTCTCAGACCCG
AGTCGATGGGGGTCGTGAAGTCTGGAAGGTGCAGACCGCACAGGTGATGGATCGGAGGAGGACAGgagtggaggagctggttgagaCTACGATGGATCAG
AGGGAAAACTCTAGTTACATTTCGACTGCGGGTGACACACCTCCTCGAGCGGGGAATGTCGCAATGCATGAGGCTATTTCTCCGGAGGAAAAGCAGACCA
ACAGGCGTCGAAGTGATGCAGCTGGGGGGCGTGGTATCGATTCAAAGTGCACTACCGACGAGGTGCGTCCGCCGACGAAGACATGCCGCTTGAATGGCAA
AAGAAAAGAGAGAGATGCAGCTATCGCTCCGATTCGGCTGCACACTGGTGCTGACAGCACCATCGCCTTAGTTGGCAGCTCTCAGCAGCCAAAACGACCG
AAGATTATTAGGCGGATTCATAGTTCTAGTGACGCTGAAGCCGTACACACCGAGTCCATTGGCGTAATCGAGGACAGCAATTCCTCTAGTTTGTCGTCAG
GAGATCTCGACAACGAGGGCAATACCGTTTATGCAACTTCAAATGGGGTGTACAACGATGAAGAAACTCACGGACAAGATTCAGTCCTGTCGCCATCTCC
AACACGGCGTACAGTGGCGTGTTCTGTTCGAATCGATCACAGTGAGCGGGGTACTTTATTTCCAGCATTGCAGAAGGTTGTTGCGGCTGGAATGTGCATC
GGTGACGAAGCCGATTTTGAAAAAGATCAAACGAAATGTATCTCGAGCacgcgagctcgagctgtAACTCAGTCGACCAGTACCACGAATCCGTTTAACC
CACTTTGGTCGATTTTGGAGAGTACAACAACACGAGTTTACAAGGTGCTAAACAACATCTGTGGGTTGTCCCCCTTGCTTGAAGCTACCACGGCTCAGGA
CTCAATGGACTACGATCTACTATGgatcgaagaagacgatcaACAACACTGGACGATGTTTGGCGAACCAAGTACTTCGGGTAGGATTGGTCTGAAAACT
AggctccagcaacgcgaaCAGATCCGTACCACCAGGTCAAAGTGGAAGTTCCGGAAAACAAACTATAGATAGCGAAGTTGATGCTACAAAATAAATCTTG
ATTCTTGCTTCGCTTGTTGACTACTTCATTTTCTGTTAGCGACGATGACCGATAACTTCGGCAAGGACGTCTCGGACATTGTTCGCAATAAGGAACCACG
CGAAGAAGCCCGTGATACTCTTTTGGATGAGTTCCACGAAAGCCAATTGACTCGACACCGACTAAACAAGGGTTTAGTGGCCAAAACTTTCGCCACGCCT
GGCTTTCTTGAGTGTGACTGTGTGACTGCCACCAAGAGAGGGCGCTACAACGAGAACGTTTGCGGTGCCCACAAGCTAACCTTACGAAACTCACGACCTC
ACCTGGAGTCGATCGAGTTCGCGCAGAAGATTTCTTCTCACGCGGAACAAAACTCCCCGTTATCTAAGTCGATGGCATTGCTGCCTACTTCGCGGCATTC
TATCGTTGAATCATCGGGTGAAGAATTTGATTATGTACTGCTGAGAGCCTTCAAAAGCACCAGCTCtctccgccagcagcacaacttTACCACCGAACCG
TCCATTTCGCTGTTGCCTTCGCTGAACTTTAAGAGCACGGCACGATCCCGAACCGAAGGTGGCATATCGGAAAACTCTAGTGAACGCAAGGGATTCTCGC
TGGCATCGCTGACACTTGATGCACCGACGACTCTCCCACTACAGGAGGTTCAGAAGATGCTCGAGCAGTACAACAAAATTATCCGCCTGAACATGGAGAC
ACAGAAGAACTTGGCCATCATGTACACGCGGCGATCCACTCTTTTGGCAATATTGGGAAagtttccagcagctctgttAGATGCCGAGCAGGTTGTGCTC
TTGGACCCAAAGTCAACCATAGTAGGTAAATTGTTTGCTATTGATGTTGATCAACGTGGACTAACTCACTTGTTTCGACTACTGCAGGGATACTACCGCA
AAGGTGCCGCATTGTGTGGACTTGGACGGTTTGCAGAGGCGAGTCGAGCTTTTCAACAAGGCCTAGCGTTCGATGTAAATTGTCGATACATGCACCATGG
ACTTCAACTAGCACTGAATCACTCGCGATACAACAATTAACCAACGCGAAAAATATACAACGTGTTAAAATTCATTGCAGACTAATGCACTGAAAACGAA
AGCCAACGATATGACTCTCTAGCTAAGGTAGGACTGATGCGCCCACTCTGGCATCCGTGTTGTCGGCAGCTTCCGTTCAAACTCTTGGTCTGTCAATCGC
TCATCTATCGGCGTCACGAATTCGTAGCTACTTAACATTGGGCCAGCGTACATGACGTTGTCCACAACGAAGAATCCCATCAAGGGATTTCCAACGCCGA
GGTGTAGCACGCCTCCTGGGTCACGGTGTACGGTTGAAGGTGAATCTGTATGAACATCCGCCACGATCACGTCGCTTTTACCGGAGTCTTCGCGGCTTTC
AAAAAATAATCCCGGATACCATCCACAGTATTTCGATCCTCCACTTCCGAAGCGCTCTTCCATTACAGTCTTCAAGAAATTCCCTTGTACTTCGCTTAAC
GGTTTGTGCGCAGCCTGTAACACTGCCATCTCTTCAAGCGACTTCATTGTTTCCGCAAAAGCACGAAAAAATCGCTGGGCTTTGCTCATCAGAAACTTGC
TGTCGGACTGGTGTGAGGCCAATCCGAGTTGGTTTGACTTCTTTGACGGGTTGTGTGAAAACTCAACCAACGGATTCAGTACTCTCTCAATCGTGTTTTC
CATTTGCGTCGCTAGCTCTTGCATTCGCCGCCAGAAGAGTGGATATGGATCCACCATCCCGTCTGCGTACTCGCAGCCACATACCATCGTGTAGCTTTGT
TTTGAGTAAAGCAAGGTATCATGTCGTAGCTGCGTAAACGATGCAAGCTGCGTATTCAtttggcgctgctgccaaacATTCGAGTGGAACGTGCGAGCAG
CATTGGGAGATGGACTTGACAGCGCGCGCAGAGCTCGCTGCCACAGCGTACTGATACTTGCACTTCCGTCTGAGGCATCAGGAGttttgccttcttcgtc
gttgaATTCTTGGTCGATAACTTGTCGGAGTGCCACAAGGTTCGACGTGAATGGCATGCCATCTCGAAACATAACAAACCCTGGAGCGCCAAAAGCGACG
GATTTTGGCGGCTTGGCATTCATTCTATCGGCcagcacttgagcagcactgTTGTTGCCAAATAAAGTGAAAGCGACATCGACAGCGCTGGGAATACGTC
GCTTTTGCTTTTCATCATTGTGAATCACTTGATCGAAGACCAgtctggagaagatgaacgAGCTCCAGACGAAGCGCTGCCCAAGAACTGCAAACGAAGT
TAACGGAGCCATGGGTGTCGTGGACATCGCTAGTTGATCTTCAACCCGAGGATGACCATTAATCAGTTGAGCTCCCAGTCCCTTTGTGAGGATCTCGTTC
TGAAGGTCCTCCAATATCGTCAATGTTTGCCCGTTCTCATCTACCATTCCGCCTTCCATTGACTCTAATCGTGCAAGCTGGCTCGGCGAAAGCGAGTCGG
CACCAATTCCGCCATCAGCCATCAGACTGGAGATCAACGAGTCAATACTCTCCACAATCTCCAAGCTTCGCGACTGCTGTAGAAAGCGCACTAGCAGAAC
CGCACAGTGTAGCTGGTGTAGATCCTCGGCCGGATTATCGCCGCCAGCCACTCGGAAATCGACCGTTCCAAGCCACATCATGGCTCGGAAgtactgcttc
agcttctcggaCTTCGTGTAGTGTCCGCGAGGTTTGAACTGAGAGAAATCGACATCACGCTTTGCAGACAATATCTCCGCCTTAGTTGTTTCTTCGGAGT
GAATGAACGACAGCAAGCGTTCCAACTTGGGGGTGTTCTCAGAGGGGCCATCCAGTTGTTCCCCTCGCACAAGACTTCGTGCTACCCGGAGAAATAACTC
CACATCCAGAATCGCTTTCATCTCGGTGGAATTACTGTTTGTAGCACCAGTGATGGCGTCGTGACACTTTGAGAGGGTCGTTTCAAGGACTTTGTCCAGT
GTTGGAGAGAGTACCTGCACTTCCAGATCCACCAGGAAGGCATCAAAGCTGCGGTGCCACGCGTGCAAAATGGAGTCGGACGTGACGAAGACCGGCATAT
CGTCCGTGTACAGTCGATAGTAGATATCTGTAAAGCTCGCAGCAGGCATGCGCGCCACTACGACGACTCCATTAGCAGCGAGCTTGGTCTTTTCCACTGG
TTTGAGACGGTAGTCAGTGGtttgcatcttcttcagcgggTGGTGCGTCTTAGACATCAGTATCTGGTTCACGTACTGAGGGTCATGCTGCTCCCGCGCT
TCGTCACGTAGACGCTCAGTTTCCTTTCGAACATCCGCAGGATCCGCATCAAAGAGGTCGAAGTACTTGCAATCTTCCAGCACGACCGGTGCACCGCCTT
CCATGGCATTGGAGTCAACAGGATAGAGCTTCACTAGATCTTCAGACGTCAACTTCGTGCCAATCTGCTTCAACCTCGCTGCGAATGCAGCCCCCACGTC
ACCTCCACCCATTTCGTCGATGTCCTTGGTCTTTTGCCGGAAAAGGCTCAAATGAGCATCGAATAGACGTACGCCTTCTCGAGCCAAGATGGGTTCAGGG
TTTCAACCCATGACATGCACATTTTGAAATTCACTGATATTCATGTTTCCAGCGCCTAAACTAAGGGATACATTGAAGAGCAAATGCTTACTTAGTACCT
TGTATTATGCTTTGCAATGCGTTTGTCGGTTTATTTATTGTTTTGCTCGAATTATAACAGCAGATTAGATATTATACCTCGAAGTACAAACAGCGAGTGG
CGCTTACAAATCAACAATCCATTAAAATCAAGATTCCACCTCAAATGTTCAATTATTCCGAGTCGAGGGCGATGCCCAAGACCCACACCATCAACTTGAG
TCGGACACCGCACCGCGTAGGAATGCAGTCTAAATTTCCTCCACTCGGCCTGAGTAATCTGCAAACATATCGCTCTTGCCTTGTGCGCGTGCTTTAGCAT
CAGCCTCTGCATCCAGAAACACCAAGACTTTCTGTTAGAAAAACAAAACATCACAACCTGTAAAAAAAAACCGTGAGCTACCTACCATTAGAGCCTTTGC
CTTGTGAGGGATGAAATGAGTAGTGTGGAGGGTTAGAAGGGGTCTGCCGAGACGGTCGATGGGgcgttggcgacggcggacgCACTGGCATTCGCTCGAA
CTCTCGTTCCAGCGCTTCAAACGGATTCGAGTCGCCACGACCCAACATAGCACCACCGAAAAAGTCTGCCAACAgtacagcaacaacaaaacaaCAATAA
GTACTGCACCACCAACTCCATCACCGACAAACTAGCACCTCTTCAACTACCTTCAAACGGACGCAGCATTTCTTGTCGGAGGAAGTCAAATGGAGTCATC
TGGGCCTCGAAATCATCGCCTCTGCATCAAACACGACCAAAAGTCAAAACCCCACCCCTTCAATCTCAATTATCCCTTATCAATTGACTAAATACACGTA
CCGTTGCTGGAAAAATGTTCCAAATTCCTGTTCGCCTCTGCATCGTCCGTGGTTACCGACATCACCAAATTCCCAGTTAGTAATTGTATCCACCTACAAC
AATTACGGGAAAACCTATCGCCACCGCTCACCCTTTGCGCGGGTCCATCCTTTCCCTATTGAAAAAGTCCCCGGCGGCTGCTTCGCCGCCATGTTCGTCC
TCTGTGATCTCCTTGCGGTTCGAGATGAGCTCTTTGCGGGAGTTCGGACACTGGCGgaagatcttcttgatgatctcgCACTTGTTGTCGCCGTTGATGG
ACCTGCAGGACTGCGACAGAGCGGTGGAGTAGAAGCAGCCTGGGTTGACCTCGCGGTCCTTCCGgatcagctcctgctcctcgtcgctcagcgTCGGCAT
CTTCACTTGTGCACGCTCTCACACTTTGGTCCTTCTGGAACAAAACTGCGATTTGATGTGGACCACCTAGTTTACCACCATTCTGTGCTTGAAACCTGTC
AAACGGAATATAGAATGCGACTTCAATGACGTGCACTCTCCCGAAGAGTGCATGACCTTTTGCTGCCGTTGAAAAGGTATTTTGGCGCGCATGAGTGATT
TGTGCTCTGGCCGGTGTTTTGAGATGAGCGTCGGCGAGCGAGCTAGTGCTCAGCTGGAGCTCATTTTCTGCTccagcgaggacgagcgCTTCCCCGCGAC
GAATCTGACACGGGCAGGTGGTGCTCCTCAGTACGACGATACTCCGACGCAATTAGCTGTCTGGGAATCGGAAAGTTCTGCGAGTTTCCGCAAGAGTTGG
TGTTTCGAGTCAATCGAGGGTTGCCGACACGCATCGAGCAGCTGAATCTACTGTCGCATCCCTTCAAAGTGGCGACTCAAGTTGAGATTTTCACGTCCTC
GGCTGTGAGCGGCTGAATTCATGATGGCAAGACTGGCGTGAGATTTGAGAGGCTTGGGTTTGTATGTTTCCTAAGTAGTGAAAGTGCCCAGTTTACAGCA
TGCGAACTTCAAGATGTGCAACTTCCCCGGCCAACCTCTAAAATCACCCTTTTGCGTCTGATTTTGCATTCTTGCCATCAAACACGAACCAATCTCTTCA
GTCAAGTTGGCTTGGCGTCAGTGATGATGTTAGGGACTCAGAAGGACACAAACGTGCTATTACCGATGATACCGTCTCCCAGAAAGAGCCCCGTTAAAGG
TGCCGcgtcacctcgtcgtcgcctttACGACACAACCTCCTTCAAGACGACGCAAGAAATTGGGATGAAACCACCGCGCGCTACCGAAATATGGGTCCAA
GATTCTCACGAACTAAAGACCCCCGAGCAAATTTGCGCTGGCATTCAGCTTGGCAAGCAGTTAGCCCAATTTACCGGCCACGAAAAGTTAGTGCAGCCGT
GGGTCTCCCTGGGGCAGGAAGCTAATCGCTTGATAAATGTGCTCGGGCGCAGTGCACACTTGTCAAGGGCGCAACCTGGTACAGAAACCACTAGTAGAGG
CAATGTACTCGAATGCTTCGCTGATTTGGAGAACCGTAGAAGGCGTCAAGAAGAGATACTGTCTCTGCTgatgtcttcgtcgtctaGGCCAGAATACGAC
CAAAATTCACTTCGAGAGCTCAAAACACCTAATGTGGTCAAACGATTTCAGATCAGTGCATGGCAAGAGAGAGAAACATTGCCTTGGCAGCTCGCCCACC
GCTCACAGAAATTGGTAGAAAGtggagaaagaagaagtcggCAAACTTGTCAACTTGAGATCACCGATGTTGAAGCTCTTGAAGTATTGGTCGCGGCACT
GGACGACTCGAACGTCcaagtgtttgctgctggctgtgcaTTTTTTCGGGCTTTACTTGCTACCTTGCGATACTTCCAAGATACTGTCGCTTCAAAGACG
GATGTTAGTATATTTGTATGGGGAAAGATCCAGCTCTACCTCCAGCTAACCTCATGCATATATACATGTTGCTGTGTTTTAGCTTGCTGAGATCGTGGAT
TGTCTTCTGGAGAGACTTGGTCCCACGAGGCACCCGTCCGAAATTTTGAAGGTAGGCGACCAAAATCAATCCCAGGAAGTCTAAGGTAACAATTTCTCAT
TTGATTCCGCAGGTTGCTGGATCCACACGCACAAGAGGCACATTTGTGACGCACCTCCTTCTGAAGCATGTTGAGAGCAAACAATTTCAACCATCAGGCC
AACAGCTTCTGGCGCTGTAGAAACTCTTAGAAGCGTTAGTGTTGTCGTTTCACTGTTGTGCAAGTTTCGATAGTGCTCCTCGGCGAGTACTTCGCTTTTT
GCTACTCTGTGACGCAGACGAACACGAGAACGCGTTGGTCCGCGATGCTGCTAAACAATTGGTTTTTGCACTTTGTAATGACGTAGATGAAGAGTTTGTA
CTGAACAACTACGTCAAGAAGCTTCCCCcggagcaccagcagcgatATGCTCTCCTTCTTAATCGAAAGGGTGATTTGAAGCTCTTGACCACAGAAGAGT
AGCGGTCAGCTAGCTTCTAATAACTCGTTATTGAAGAACGCAATGTTCTGGATCTTTCCCGCTCGTTTTGCCTTTGCCTTTTTCTTTGCCTCGGCCTTTG
GCCCCACCTTTGACAGGATCAGGTTGATTTGCTTTGTTCGATAACGATGCACCTTCAGTGTTGGGGGGTACTTGTTCAGCGACGGCTGGAATAGAAATTG
GGGGATGGCTCGCAGGTGGAGTTGTACCAAATGTTTGGTTTGTGATCGCGCTTTTTGGAATAGCAGTTGAATCTTCCGCATCGCGAGATGGGCTCTGTAC
AGCAGTAGTGTTGCTCGGCAAAGTACTTACTGTGCTGTTGACGACGGTGGTGACTGGTTGCTTATTTGTCGTTgttcctgcagcttttgTGCCTGAAGGA
GCTTGTAAATGTTGTTCAGGAGAAACCTTATTTGATCGTTTTGGGGGATCATTCCGCCGCTCAATTGTACCTCGAAAAGCAGAAAAACTTGACACGATTT
CTTGGTGACCTGCATGGTGCGACGATGGTGTCGTGGTTGACTTCTTGTCAGTTGGAGTACCAATTTCGAACACAAATGGTGCCGATTTGTGTTGAATTTC
GTCGTGAAAGGTTCCTATCGGTAGTGTTCGGGCTACAACCTGTCCGTCAAAAGCAATGTTGCCTTTTTGAAACGATTCACGCATCTCTGCTTTATCGTTC
TTGGAAGTACTTCGACTTCCACGTACAAAGGAGTGTCGATAAAGCGCGGTTGGACGAGGGTGATGCGAAAAATATCGCTGCAGTTGTGTGTCAAATTCTG
CTACCTCGGCATCCAAAAGCGGATCTTGAATGAAGAAAGCAGTGTGAAAGTATCGGTGCGAATGATGGCTGTTTGAGTTGTTCGATACTTCTAGATGTCT
CCGCACAGAGGTCAAGAGGTTGGCGCGATAGTTTCTTTGGTCTCTACTCAAAACAGAACTGTCAACTTCTTCTAGGCACTCCGAAGCAAGACGTATCGTG
AGTACGTCTCTGTCGCCGCGTTCCATTGTTGTTTGGTCACTATGTGTAAAGTGTTTTGGAGTTAAAATGCTGGTGCAAAGTGCTTGAATATTTGTTTTCA
CGTTTGTCGAAATCTGGCAGCGAATAATTTCGTTCCTCAACGCCAGACGGAGCAACCGCAAACGATTCCTCGCAAAAATGATGCCTGAAGCATTCCCCGT
GGGAGTTAGATCGAGAAGCTCATCGAAGAATTTCGTGCGCGTTAAATCTTGTTCGACCAGCAAGCGGATAAACTGCAAGAAATCTCTATCGATCGACGGT
GGCACCTGATCAAATCGACTCAAACCTTTGAGACTGCGAGAGCTGGTACTAGATGGATTTGGCTTACCAGTGTGGCTAATTGACCAGCAAAGTGGACTCG
CGAGGGCCCACTCCAAAATAGTTCGCAGGCCGTATCCCCAGTTGGTACAAGAAACTTCTTCGATTAGCCCTAGTGCTGAAATGCTTTCATGATCCTTGGA
GCTGCTACGTTCAGATTCGGGTTGGTGTGTTGTTTTATTCACACGTGTCACCTCAGTTTGGAATACGGTGTGGGCTAGATGAATTGCTGCCTGGAACACT
TGGGATGACTTTGCTTCTCGAATACCTAGCACGATCAGCGCGATAATACCCTCAAACGCAAAGATTGCGCCAATTGCCTTTTTCATGAGAGGACCAGTAC
GTTCAACCATTTGAACGCAAGTCACTTGAATTTCCGATCCACCACAGAGCAAACACTGCGTAAAGAATGTTCCAAAGGTGTACAGCGTGATCTCGTTACT
GTTAACGGGATCAGTGAGTGATGTTGTCGGGGGCTGCCACAAGGAAACCTCGTCTGTGAGCTTGGATATTTTCGTGGCAAGAATTTCTTCGAGCATTGCT
CTCTCTCGAGAGGTTTGATCTACGTACTGCCTCAGTGCTTTGTCGAAAGGTGAAGTTGGCTCTCTTTCttcgttgttcttgttgctaCTTTCTTGCGGTA
GCAGTGTGGTATTTCCAGGAGCTGCTACGAGTTCGTTGCCCTGAGAGTTCGATTCAGGGGCGACCACACTAGCTTCAGCTAGGGGTGGTTTACACTTTTG
TTGCGAAAGAAACAATATTTCAGCTTCAGTTTCAGAAATCTTGACAACCTGTGCTACAAGGTCCATCGACACCCCTGCATCCAGTAAAACTGCTTGCAAT
TCGTCGTTGTCATTTGTGAGAGGAACCAACATGGGCCGATGAATGACGCCACCAGACCGGTGGTTTGTTAGCTCTTCCTCACATTTGACGGTGCGACTTT
GATCCAACTTGGAAGCAAGAGCCAAATCTTCTGTTGATCCTAGTAATTCAATATCTTCCAGCACAACCTGTAAGCAGGTACAATAGTTGGTTAAGCAAGG
TGTCAAAATATGAAATACACAACCGTAAATGTACCTGTTCAGATTGGTTGTGGAGGCTCTCGTGTGGTGCATGGATTACGAGTTTGACAAATGAACACTC
CGATATATCCAGACGAACGATTTTGGTATCGATTTCTTGAGATGTGTCTAACGTTGCCGACGAGCAGGTCTCCCACACCAGAGGTTCGCTGCATCAAGAA
TGTACCATCAGAATTACACATGAGGCGGAGAGTACGCAGTGCACTAGAGTTACAGGTAGCCATACCAACATGGTTTCCAGTCAACACTAAGATAGAGAGA
CACAGCGTCAAGAGGACTCGGTGCATTTACGCTTCCTTGCCGAGCTGGCAAAGCTGCAGAAATGACAACTTGGTAAACAACCAACAATTAGTGACTCAAA
TGATacgcttgaagctgccattGCTTCACTTACTTTGAGCTGGAGCCCGGGCAAGCTCAAGTGTCAGTCGCAGAGACCTGACCGTCGCGGGCTGAGGAGA
TAGTAGAATCATCCCCAGCTCTTGTGGAAATGGAATGTTACTGCATCATCAACTGGTTAAATGAACATCGAAATTGTAGAAGTGCGGGACTTCATGGCGC
TTACGGCTTAGATTTCCACAGAGGTTGGTATTTGGACTCCTCGACGGCCCCGGGTGGGTGCCAGTTGTGTCGATCATTTCGAATAGCAGCGTCTTGCAGA
TCTAACTCGTTCACGACAAGCAACCGGAATGGAAGACTGTGCATTGCACCAAGCTGCCTTCCAAACACCGTCTACCCACGAGAAGGAAACGGCTCGTCGC
CAAATAACTCAGGCGAGGGGCACTCAGTCTCGTTAGAACTTGGTCTTCAGAAGATATCCAATCAATTCAAACAATCATTTTGCTCAACTCCGAACCATTC
AGCAATTGCCGCTCATGAATCGACCTATCTTACTTGAGCTCAGAGGCGCCGGTGAGGCAGTTCATGTAAATATACGTGTCCACACCGTGTCCCTCCATGG
GCATGGTCGCCAGCTCGCCGCCGAAGTACTTGGCGTAGAGCTGAGCAATACGCAGGCCGAACGAGTCCGAGAAGTCCAGTCCGCTGGCACGTCTCTCCAA
CACCTCCGCGACCGGGTCGTATCCGCTCGAGGATGGGGACGTCGCCGTGTGGTAGTAGTTAGACAGCGCGTTGGCTTCCTTGCGCGTCATTCCTCCACCC
AAGTCGGACACCTTAACGCACACGCCGTGCGGTCCACCCGAGATCAACACACTAACAGACGGAGAGGAGATGGCTCCCGTCCGCTTGGCCGCAGCGACGC
TGTTCAACACGGCGTTCTTAAACACCTCCGTCAAGATGATCTCGATGTGCTGCGGGACGTAGCGGTAGGTGGCATCCTTGTCGCCACTCACAATAATCTC
GGGCAGTTGGTCGCCACCGAGACTCTCCTGCCACAGCGGACGCACCTTTTGCACAATTTCCTGAGCGATCTTCACGGGCGAACACTCGTCGTTGACAATG
CCCGTGAATCCAGGTTTCGGGGTCTGTGCCGCAAGGTGCTGGTCCACGAGCATGCGGATGCCAATGCGGGAAGTGTAGAAGTTGTCGAGCGACTCGCTCA
GTCCCTGGGGCTCGTACTCGAGCGCCTGCACCGCCTCGGCGATGTTGCCATGCATGGTGGCATGCTCCTTCCTGATCTTGCGGTGGAGCTCCACAAAGTC
CCCTTCGCCCGAGAGGTTGGCGGGTAGTGGGCAGCTCATGAGCTGGTCAAAGCtgtccaggagctgctcgcgcagaGACACGATGGGTTTGGCTtgcggc
agctcgtccgGCAAGTTCTCGAGGTCCACGAGGCGGCGCGCGATGCGGATTGGCACTTCGCGGTGCAGTAGCTGCGCCGACGTGACGATAGCGGGTGCAT
TCACCTCACGCCACTTGGTCAGCGCCTGCGGGtcgttctgcagcgacgcggCGATGGCGGGGCTGGCCCGAGGCCCGCGCTTGAGCAGTGCCTGGAGCGT
GATGGGCGGCAGCGGGATGTGGTGCAGGCGGTACACCTCGGCCAGCACTTTGGCTCCAGCGGATGAAGGCATGGCTGGTTGATTGGTAATGTAATACACG
ACAGACACTTGAAGAATGAGGTgacagacgacgacaaggctGTTGTAGGTCAACGTTTTCTTGTGGATTGCGATGTTGGAATCGGATCTTATCGATTTGT
TGCTTGCGCAAACGATTTTGACCAATAAAAAGAATAGTGTACTACAATAGTATTTCatattttagccaatgaGACGTAGTTTGAAGTGAGACCTCAgatt
cagccaatcagaagatACTTGTCATGCTGCAACTTGTATGTACCGGTAACGTTATTAAACTTGCTGGACGTTTGCGGGTTAAACATGTACGAAGGCTGCG
TCACCGTAGAACGGAGGCGTGTAGTCCAGTTTATCTTTTGCCGTTTGACTTGCACCTTTCTCGATGAGGATGGCGGCACAATTCGAGTTGCCATGCAGCA
TCGCGCAGTGCAACGCAGTCCAGCCACAGCGATCCACTTGGTGCACGTCTGCGCCAGCTGTAAGGAGGGCTGATACTGCCGCAGTCATGCCTCGACTCGC
TGCCCAGTGCAGGGCGGACCGGTTTTCAGCACTAGTCAATGAAACGCTCGCGCCGAGCGCCAGAAGCCTCTGGACGACGTTGATGTGACCATTGGCTGCT
GCACACATGAGCGGGGTCCAGCCATGGCCGTCGCGGGCATTTACCTCCAGTGTCGTGGTTTTGCTTTCATCATTGCTGTCATTCTCTGGTTGTGGCTTGG
TCATCTCAACGAGTAGATTGAGCACCTCGAATTGGCCGCAGTCGGAAGCGTAATGCAGCGCGGACCAGCCTGATGCGTCCCCGGCGTTCGGGTTACAGCC
CCGACTAATCCATTCTCGCACGAGGTCGACGTGACCTCGACCACACGCCAGACGTAGCTCCTGCCCGTATTTGTACGCCGGAGCATACACGAGAGCGAAC
GCGTTTAGCAGCTCTTCTCGAGAAAGGTGGTCGTCTGCCGGcatcacagcagcagtggaagGTGTAGTGGAGTCAGTCGGTGTGCTTTCATTGTTTGGTG
GATCTGCAACGGGCACATAATCGCGCACCGGAAAGCAGGGTACCACAAGTGACTGGTATAGCTCGTCGGAGAGAGTTAATCCTGTTCGGCGTAAGAGATC
TGGTATTCTCGTAATGGCGATGCCGTCCTCAGAAGTAGCGTTTTCCGCCGCATCCGCGTCGAGGACCTTTGTGAGGATCTCAAAGTCCCGTTCTCGGAGC
TGACTAATGCGTGCCACTTCCACTCTGCTGGGGCCGTCAATCACGCCGCCGCTTGCCGATAAAGTGGTGagacgagctgctccagttgaTGCCTCACTCG
ATGCGGTCAAGAACATTGACTCCTTCTTTGGATTTTTCACCTGCGCAATCGTCAGTATTACGTTTGTCTTCATAGCGACAGATGTTCCCTCCGCGCCCAA
GTAAATCTCCAGTGTGTGTTGAGTACTGTCCCAAGACGCCGTGAGAGTCTTATTGTGATACACAGGCGTTCGAAGCAGTACCTTTGGCTGTTCATCCATA
TCCCATCCATCCGGTggcagctccaccaacaaTTTCCCGCCAGCAGGAACTTTACCGCTGACAGTGAACGCCAGCGTCACATCAGACACCGCCCCAGGGC
AGCAGTTGAACGGACTCCAGCGTTTCACGCCGCCAATTGACCCAGGCACGATCTTCGGTATTGCAAACGCAGCGGGACCATCAATAATCTGCCCACCGCG
TGTGGACGCTGGCACGGTGCTTCTCGCCACCAGTTTCTCGAAAGTCGTGACGATAGCTTCTCCCTGCGGCGTCGCCTTCTCGGGAGTGCCAACACCAGAC
ACCACCAGCACTAACGGGGTATCAGCAGGTATCACACTCTCGTACAGCAGCGTGAACTCCATCGTGCGCGTCGATGCAACCCACGTCACCTTCACTTGAG
GCAGCGCCGCGGTTGCCGAGTTCTCGTTCGGAGACGGCAGTTGGAGCACGACATTCGGTGGTGAACCAGTAGGCAGCGTCCACCCGTGATCCGGGAATTG
GCAGGTGATCCGGGCATGCTTCGCCAACGGTCTGGTGGTCGAAAAGCTCAGCGCGAGCTTGCCGATCACGCCGGGCGTGGCGAACTCGGGCTCCAGCGCT
TTGCGGCCCTTGAAGCTGCCAGCGACGATCTTCCGGTGGCGTTGTGCGAGTTGAAGGTGTGCGCCCCGCTCTTGTTCAGCCCCAGCATCATTTTGCACCT
GCAGCGACGAACCGCCCAGTCGCTTCATGATGTCAGGAGTCTCACGCTGGCGGCACCGCCGCAGCGAAGGAAAATCCAGCCGGAAGAGCTCTACGCAGTC
GAAACCGACGTCGCGGAAGGCCTAACATTAGGAGCGATTCAGACGTTTCGACCACTGCCTTCGATTAAACCTTCAACCAGCGACACGGAGAGATGGCATT
GTTGCAATGCATGTAATCGATGGATCGAAGCGAGCAAAGTGAAGCAAGCATGGAGCTCCGCACCCGTGCGGCCAACGACTGCGACAGCGTATCAGAGCCA
GCATCTGCGAAAAAACGCTCAAAATGAGCTTCAAATCGCGTAATCCCCGTTTAATTAGATATGAATAAAAGACATGATCTTAGTTAGGATATAGATAAAT
GGAGGTCTTTGGGTAGCACGAAATGTAGGTAACTGCAGCAATAATACCAAGACAGTATCATATTTTAGTCTTTTTCGGCGGCCATGGTTGCCGGTATAAT
TAGGCGCCATCAACATAACCTGGCCTTGGCCGCTACTCACAATCAAACAGCAGGCGAACTGCGCACGTTCAACGCCGTTCCACACGCGGAAGAGGAGGGA
TCTCGATCTCTACGGCCGTGGCATCTCCACTCGATAACCAGAGCGACAGTACGCAGCGCGAAACTCCGAGGTACGTCGACATGAACAATGCGCTCTAGTT
GCCGTAAAAACTCACTTCCACCTCCATCGTCTCTTAAATGTACAGCTCCGTCTGATCCCAGCCAAGCCCCCGCGGTCACTACCGAGCCACCTTCTCCTCT
CTCTCAATTCTATTCAGCCGACCATGGGGAGACGCTGGCAGCTCCGTGACAAGGCGAGCTTCGTCAACTATGTGAAGATCGAGATCCAGCTGTTCCTGAA
GGAGTGGAAGATCATCCTGCCGTGCGTCATCATGCAGTACGTCCACGCCATCTTCCACAACCTGGCCTACTACATCCAGGGTAACTACCTGTCGACCGAA
CAGCGCTTCACGCTCTACGACCTGGGCTACGAGCTCATGCCAGAGATTCACGGTTTCGCGGCGTCCCTTTCGGATATTCTCGTGTTCGCCGTTGTATTCG
GCCCAGCCATCATCTTGGTGCTGACGATCCCTCTCTTCAGACAGGAGCCCGGCCGTCCGCGCTACCTGGTGGTCGTGCTCAAgcgctgtctgctgcagct
cagtATCTGTCTGGTCTTCCGCATCATCTCGTTCCTCGTTACGGCCCTCCCGTCCCCCGCCGCACACTGTGAGCTCAAATTTAACGACACGTGCTTGGCA
GCGAACCCGGACGATCCAGTGCCGTGTGTCGTTCCCAACCTGGACTTTAACCCGCCCACCGTGAGCGAGTTTTTTACGCGTCTGGACTCGCTCAATGGCT
GCGGTGACTTGATGTTCAGCTCCCACACGATCTACACCATGTCGCTCATCCTGACGATGTGGAAGTTCTGGCTCAACAAGTTTGGACTCCTAATCATGGT
CTGCGTGCAGATTGCCATCGCGTTCCTGATTGTGGCCTCGCGCAAGCACTACACGATCGACGTGTTCTCGGCGCTGTACATTGTGCCGCTGTTCTGGTTC
ACGTTGGAGGCGTACCACTACGACATCAACCACAAGGACTCGGAGATCACGGTCAAGACTATCTTCGACCACTACGGAGTTGACGTCTCGAGCGACGCGA
ACGACGGTGCTGTGCCGCTTAACACCAACGATGTTGTTCCGGCGGCGACCGATCCGTTGAACTCGGTGCAGGTGGCGATGACGGAGGATGAAAGCCTTAG
CGGCGAGCGATCCGACCCTGATATCTCGGCCACCAGCTTCCAGCGCAAGAACTCTGTGTAAGGTAGATGGAATACTACATATGCACATCAAAACGACTGC
CTGGAATTGACCCGAGTACGCAATTTTTCCACAAGTTGCCTTGTTGATAAGAATTCTCTTCTTTGCATGACTGATAGACGCTTTAACCCTCGCATTGTTT
CATTATCGAATTCAGACTCTCCTGCGAGGCAGTGCCAATCGTAGGTAAGGTTATCCGTAGTAAGCACTGATCTGCGAGAGTGTGTCCATGTCTGACAGAT
CGTCCGTGC