Description :
From Genome Similarity Track
Location :
contig_18:304346- 305370
Transcript NameFunction/comments
g4406.t1hypothetical protein

Sequence
1024 bases(100 bases per row)
GCGCTTCGAGTCTCGGCGCTGCTTGGTGGCGACCTTCACATCTCGAGCGCGCTCGCTGAGGTGTTGTCGGTCGTCGCGCTGCAGCAGCTCAAGCGGGACG
TCGTCCTCACTACAGACGTTGGTGATGACTTGCGGTTCCCGCTCGGTCGATGTGATTCGACGCGCAGGCTCGGCCTTCGCTCGCTCCGCGTTGCGCTCAA
CGGCAGCCTTGCTGCGAGGAGTCATCGGACTCCCTGGATGGAGAGCGCGTTGCTGCTCCATGAGCTTCGGGGAAGCATTGGGGTCGTTGACCTCCCCTTG
CTCGAGTCCCTTCTCGAAATCCGACTCGTCGTAGTCGACCTCGTTCGAGACGTCCTCCGAAGGCGAACTCTTCGCGTCCCGACTCGGGCCTTGATCAACC
TCCATCTCCGTGACGGACGAAGCCCGATCGGCGTCAGCCTGCTTATCGTCCGCAGGTTGCGAATCAGGGGCGTCGTGCGCTCTGTGATCCTCTCCTTCGA
TTGTCGAGTCCCGCAGGGCACCCGGCTGGGTTTCATCGGGCGTAGAGGCTCCGCCTCTAGCTCTTGGAGTTTCCTTGCCTCTGGCCGAGGTCGTTGGAGG
CGTTGCCGTAGGTGCCAGCGGCGTGTGCTGGTCGTTCGCTCCTGGAGCCTCCTCCATGTCGACATCCGGTCTATCCTCGTCGCCAAGAATGAGCCCAGGG
TTCGTACAGTCGGTGTCCGACTCACTGCTGCTGCTGGCCTCCTGCAGCCCGGGCAGTTGCACCGTTGTGCGCTTGCTGCTGGATCGGGACTTGGTCTTGG
CAGCCTTGGATCGAGAGAGCGGACCGCCTGGCTTCTTGGAAGCGGACTTTGCTCTCGGGTGTTTGGGAGGCTTCTGCGCCTGGGCGGCATCGCCTTTCTT
CTTGGCATCGGCAGCGCTACGCGCTTTGGCGCCGCTGTCTTCGCCATCCGGATGTGGGCGTCTCGGTCGCGTGCCCGTTGGGCCTGGTGTGTCCTCGGTG
CGTGTTCGCTCGGGCGCAGAATGC