Description :
From Genome Similarity Track
Location :
Scaffold_85:3043- 9939
Transcript NameFunction/comments
Phymu_g3830hypothetical protein
Phymu_g3831conserved hypothetical protein

Sequence
6896 bases(100 bases per row)
GCCTCGGCCGCAGACCCTCGAGGCGTGTCATGATCCTTGCGCTGCTCTGGCTGAATACCTTTCAACGACGGGACGCGGCTCTCAGACTCTGAGTCGGAGG
CCTCTGGGCCGTCGTCGCCCTGCCGGAAGAACGCCACGAGGTCTGCGAACACATTGAAGCTCACCTGCAGCAGGTGAAAGTGAGGTTAAGTGTGCATGTA
GATTGACTATTGCAGTGTGGGAACTGCCAGTCGTACATTGAACGGGTAGgcgatcttgaagcgcaCGAGCGCCTCTGTGAGCTCGCTGGTCGTCACGCCG
ATCCCTAACACATTGACTAAACCCAGTCGTGCTACAACAACAAGTAGAGAGatcaggagctgcaaacACACACTGTATCCATGATAGCGCATATCACACG
TACTCTGTGCGACGGATAGCAGGCCTCTGCCTTCAGTGTCAGACTGAGAGAAGGCGGACCAGAGTAGCTCCATCGGGTCGTCCACCTCAGCAGTGTCCCC
AGCATCACCGTCGCTCATATCCGAACCAAAGTGTCCAAActcatcgtccgagtcctcctcgtcttcgccctccccgccttctccttcctgAACGGTTTCC
ATACGCAGTCCAGGACTCAATTCTTGCGGCACGCTCTGTGCTTTCATCTCCCGCGCCTTCTGCCGAGCCATCTTCTTCCGAGCTCGAGTTGCTTTATACG
CTGCCAACACTTTCTTTTGCATCGCCAGTTCCTGCGCAATCACCTCAGGCTGTCGGGGATCAACCACTTTGTAGCAATCCTTGATCGCCTCGCGATCCTT
TTGCCACTGCTCCCACTTGGCCCAGCCGCAATGCATCGCGTTCAGTTCAGCATCAGACAGCGGCAGAATCTGCACCACCCGCCTCACAGTCGTGAATTGT
TTGTGTGCCACCATGCGCTTTGACTCGCTGAAGTAGCTCGGGAGGTATTTGCCAGCAGTAGCCACAGGCGTTTGAAGTCGCACGAATTCGTCGAAGGGGG
GCTTTTGATGCCCAGAATCACCCCCACGTGCACTCAGTCGACGTAGAAACACATGGCGCTGGGGAGTGGATGAATTCATTCCCATGTCACCTACTTGGTT
TTCAGACCCTGCATCATCTAGGTATCCTGTGATGTCTTGGGGTCTCAGGATCTCTAGCCCAGTGCCATTGCCATTGAGGACGAAAATGTGGGGCTGAATA
GGTTCGTTGATGACTGCTTTTGCTGGAATACTATCCACACCGTACCGAGAAGCCTCAGCGTCACTTACGACTCCAGCGAGGTCAACAGAAACGAGTGGCC
CGGGCTCCTCTTCTGTCCCGTTGAAATCAACGCGGAATTGGTTCTGCTCCTTGTCACAGAACTGGAATTGGGCCAGCCGATAGTCGAAGTAATAGACCCC
ATTGTGACTTGTCACGTTTcgatcgtcgtcatcttTCGAGCCAAGGCCACATCGATCTTCGGCGCTGTATTCCACTCTTCCACTGTCTTTTGTCACAATG
ACTTGTCCACTGGGTTTCCGCGTTGTAACACGGCCATTCACCTGCGCCGTCACCTTTGTATTGTAGCTGATCTCCACACTCGTTCCGTCATACGCATTCA
CAACGCTACGCACACGTAGCCCCCCTTTCCTAACTGCCACACGCTCTCCTGCTGCATGGCATTGAGCTGTCGCATTGACTTCCACATCAATGCAAACGTC
GGCAAGCCCTCGCTTTGTTACAAGTACGCGCGAGCTCCCAGCATTCATATACATTCTTGTGCCATCCACATGATACGTCACACGAGCCCCGCTTGTAAAT
GTGACAATAATGACGCCGCTGGGACGTCGCTCTACCAGTGCATTAGTCTCAGGGTCTACTGTGAGCGTCGTAACTGTTGGAGGGTCAAGTTCTGTGGTAT
GGCTGGTCCCCTTCCTCGAGTTGTGGTGGTGTTTCGTACAGCCATGAACAACACGTACAAGTCCACTTGCAAGCAAAACTTCTTTTCGCCCGCATCGAAA
CACCCGAAGAACGCTCCCCTTTCCGTAAATCACACGATACTTCTCATCTTCATGACTTTCTCGCAGCTCATTTAATTCTCCCACATCGGGATCAAAAGAT
TCATTCGTGTCATTAgccatgaagctgttgctccaTTCTGCCAAAGCGTAACGCTGAATGATGGTGCCATCCGAGCAAGCAGACACAATAAGACCATTTG
GAAACGAGTTAGTCATCGTGACAGTAGGGAACTTGTCAGGCTTTTTAGGGAACTCTCTCCTTCCCTCGGAAATATGCACTGTAGACTCGTCCTGGAAGGA
TGCAACGAAGTGCGTCTTAACCTCCAAGCTCTGTCCCGCCCCCGATCGTAATCCAAACGTTTCCCTAGAGAAATTACAAGCGTTAGTTTGAGGAAGTAAT
ACATCAAGCAAGATACAACGCACCCATCGCGATAGACTGTGAGCCATACCAATCCTCGAGGTGTCTGATACAGCCGCACTACGCTGTGATCAGCAGGATA
CATGGCCCATGTCTGGATGCCTACAAACGCAAGCTGCCCAGCTGACAATGGGATACACGCAcgggctgcagcttcggtgCGTGGTGTAAGATATTCGTTG
GGAACAAGTTCTTCGCGCTTCCAATATTTGAATGCTGGTCGGTGTCGTACATGGTCGACCGCTGCCCAGGAAGACACTTTGAATCTACCAGGAGCGGTTT
TCGGGAGAGTCGCTAACAAAAGCGAATCCGTAGGCGCGTAGTATCTGGAACACACATCGGGTGAGTTTTGCTGCAATACCCACGCGATTCGTTGGGGGAG
AACTGCGCGCGTCAAGTTCTCCATAAAAGCGCGGGATTGCAATTTTCCCCTCCAGGAGCTTCCTAGCATCTCTTCGACTTCCAGAAGTTGCTGTGTTAGA
TGGACCATCCAGCAACTGAATCGAGGCGAGTCGTAAAATGTTGCAAGCTCTGTGTTGCGAACAGAACGCTCCGGCTCAGATAACTCTGGTACTCGAGGCA
TTGCCTTCCGTCCTTCGTTACCTACACCGGGCAAATCACTTTGCCTCCACATCGCTCGTTCGACATCATCAAGGCGATGGTTCCCGTGGGCTATGAAGCA
GGAGTCCCCTGCCTCTTGCAATAATTCGTGGAAAAGCtgagcaccagcaagtcGACATGAAACTAAGTCGCCATACTCGAGAAACTCCTCAAGTTGATGT
GAATCTGCCTGGTTATTTGAACTGGTACGGTGCTGTGTAACTGGTGTCGTTGCAACGGGGGAGACCATCGCTACAGCCTCAGCGATAGCAAATAAAATCG
TACTGACGCCAACGCTGCCAGGATAAACGCCACTTAGCACTGATCCATACGCTTTGCAAAGCGCATCACTCTCGCCCTCATTATCAGTCAAAAGAGGAAT
CACAGAAAACGTTGTTGACCCTACCCAGCTCTTAAATGCGAACTTCTGAGCAGCAATCGACTCAATGGTTGTGATCAGCTCCCGCTCAAGCTCGTCAGGC
GGCTTGAGCTCTGACGCTTCTGTGCTGCAGCCTACGTTCGTGAAAGTAAAGTCGCTCCACTCGAGTCCACCCACCTGGGCAGCCTCATAAAACACCTTCA
CAACAGAATTTGCGATCTGAAACACCGACGTCTCCGCCATCGACGTTCTTGGAGCATTACCGCCCATTTTCACAACAGATTTACGAGAGGGATtacttga
gctgcttctgtttCGAACCCGACCTGCTGACATGTCTAGAGGATCAGCTAGAAGCACCACCCCGTCAATCAGCGGTAATAGTGGCAGCTTTTCGGGTCCG
TTCGTACTGCCAACCTCTCCCAACCTCAACAGTTCGTCTATCTCGGACAGGGAGGAAGGGTAGTCCACTAAGAGGTACACACGCGCAGGTGTCTGCACTA
ATTCTTGTGGTCTCTCCGCGTACTTTTCCCCTGTATCTGTCCCTCCTTCATCAGCATGTGCGTCTGTCTGCTGATACGCGAGAAATTCTCGCTTCTCCTG
ACTAACGAGACGCTGGAaggccagcgccagcaacgacGGCGTCACAGTAACTCGCGtcatctcctcttcctccttctcctctgcatctcctgcacCCTCT
TCTACAGCAGTTTCCTCCTCGAGTGCCTTATCTTCGTGCTGTTTGGCCTCTAATTCCTCCGCATACGTCACTTGcacgagctcctccagctccgcgCGAC
CCACGACACGatacgagcagctcctcgcccAGCTCGACAGCTCTGCGTCCGCCTTCAGCctgttcagcagctccttttTGGCCGCCAGATCCTCATTCGC
CGAGCCGCTGGCGAGCGCCACCGCGTGGAACCCCCAGCGCCTCCTCATCATAttcgttgaagttggaggCCCCCAAGTGGAAGTTGTCCCTGTTAAGTGC
GATCGAGCCAACTTCGACTCAGAAGCGGATCAGACGGCAATGgtcctcgaacgtctgctgctcgcggCGTGTACGCTCGTTCTGGTGGCGGCAGATGCTC
TGTGCGACGAGAGGAAGCTGCATCGGGACGCGGTGGTGCTACTGGCTGCTcacgtggacgtggagctggGCGGCGTCGGAGCAGGAAAGCGCGAGGTCGT
GGGCTTTCAGTATCTGGTAAGTAAATGGTGACAAaaaaccacttcaacaactACAAAACGTATTCATTGACGAACGATAACGCCGCAGAAACCTGCCGAA
GCCCTTTTGGCAGCACAAGCGCTGGCTCATGAAGACTTCAACCAGGCAGTGGGGCAGGTCCAGCGGATCCTCGAGTACCAGAAGCCAGACGGGCTACTGC
CGCACTTGGTCTACGGGCCATCCGTTCCGTCCAAACTGCGGTGGATACCGAGCAATCGCACCTTCCACCCGGGTCCAGCGTTCTGGCAGCAACCGCTCCA
AGaccaggaggaagaggagagcCCCATCTCGCCCCTGCACACTTCGACGATTTCGGCTCCTCCGGTGGCTGCAGATGTGGCGTGGGAAATCTTCCGCTTG
GCTCCGTACGACTCAGTGCTGGGTGTCAGGACCACCGCTGTGCAGTTCTTGTGCAGCGTTTATAAGCCactcaagaagctgcaggaacacTTGTTCTTCA
CACGTCGAGGCCCCGCCCCTAGCAGTTTGCTTACTGCTCATGTAAGGTTTACTACGAtccgtacatgtatgtacctGATGGGATAGAAACTAATGCTCAA
GTGTATTTTACGACTTTTCTTGCAGCATCCCTGGGAGACGTTTTCGTCACTATCGCCACACTGGAAAGCATTCCTCGCTGAATTGAAAACTGCACCAGAC
TACGAGGCAACTGTCAAGTCTGTCCCGGACGAAGCCCGAGCTCGctttgcagctggagctAGTACAATATTTTCAGCGCAAGATGCAGTTGATAATTTGT
ATGAACCTATGATATATCTCGCAGCTCAGATGCGCCGCGGAGAACCCAGCGAGAACGACCGACGCGAATTAACCGTGTTGGAGTCCATTGCCTACACAAC
GGATGGCAACAAAGTTGCTCAATTCGGGGTCGAAGATGTGGAATTCAATGCGCTTATGCTGCGATCGTCTTTGGGGCTTGTGAACATCGGTCGCGTGCTC
CTGGAGCACTCGTCCGTGTGCACGGGTTTCACGCTATctgaggaagagcttctgcgcgaTATGAACGAGCTTCACTCAATGGCGAAGGGTCTCGAAGTGG
CTCTCATTGGCACCAACACCACTCAAGGCCTGTGGAATGCATCCGCTGATTTCTTCGCTGATGCTAGTCGGTTCTCATTGACTTCGGCGCACTCGTTGCG
CGGATTTCTTCCTGGATACGCTGCAGAACTGGACGATGGCAAGAAAATGCGCTCGATGAAGCATTTTCTTTCGGAACCAGGCACATTTTCTTTCTTTTGC
TCCCAGTTCCCAGCTTCTTTTTTTTCGTGCTCTGGGGATGATTCATTCGAAGTCGATGGATCGACCAGCGGCAGTGCAGCAGGGAAAACCTGGATCCTCT
ACAACTATTTTTTGCAGCGAGGGTTTGCTAGGGTAAGTGTTATTCCCCACTCTCGAATTTTGCGATCAAAACCATTGTACTAACAATTTTGTATGAGCAT
TCAGAACAAATTTCCAGGACTGGCTGATTACATCCGCAACAAGACTCGAGATATGGTGTGCGAGGCAACAACAGCGTCTACTCATCTACCTCATTCGTGG
TTCTCCTCACTAACTTCAAATGAGGCCGCACCCCCCACAGCTCTATCTCCAGCCTACGACTCCCAAAACGCCAAGCCAGTCCAAGTTTTCGACGACAGTT
ATATGGGATCGACTCTCTCGGCCGCCGCACTTCTTaatgtgctgctgccagcaggTAGTTTACTTTTTGGATACGCAGTCGTTCTTTGCAACTCCTTACC
TATTTACTTTTATGCCCAACAGTGACTCCGCCACCAAGTCCAGATACGCCGCCCATTGATCACCGCATTCTCTCTGTTATCATGTGCGTCGAGCTAGTGG
TCGCGTTTGGAGTCGCGATGAGCTGTTTCCTGTTTTCAGTCTATTTTGTGGCGAATCGGCCACGAGAAACACGACCATcacctgcgtctgcagcgcgcCG
AAAATCGGCTGGGGGAAAGAAGTCTCGAGACAAATTGGATCGCCGCACGGGAGACTTGGAGGGCCGCGAGCAATCCAGTGCCAGTGGGTCGTCGTGGGCT
GAAAGGTACTCGGAGTCATCTTACAGTGACTGCTCCCCGCGGTCTGGCCACACGCCATATGAGCTAGAGGAGTCGTTGATttcggaggaggacgagcatT
ACGGATCCTTCGACGAGGCAGCGCAGCCGGAGACACCGTCCAATTCAGCATGGAAAGCCGCGAAAAAGGCGCTAGCGGACATCAGTCCCTGGTaga