Description :
From Genome Similarity Track
Location :
Scaffold_134:3043- 7034
Transcript NameFunction/comments
Physo_143269hypothetical protein

Sequence
3991 bases(100 bases per row)
GCACATGCCCAGCAGGCCCGACAACACATACTTTTCCAGCACCGAATGAGCCACTGACTCCCTTGAGAAGTCAACACCCTCCTTTGTATTTGGCCACGCT
TTTCGTGGGTGCTTGCGGGCAGTAGCTGATGCCAAACGCGTCGATAATGTAGTCGTCGGGGCTGTGGTCCAGCAGTCCGGGGAACTTGGGTCGTTCTTGG
TCTCCTGCTTGCAGGAGCGTTCGTTCTCCAGCAGCACGATGCCGCCGTCTTGCATCGCGCGGATGTCCGTGTCCACCTGGGAGCGTCCACCGTCTTGATG
GGGCGGCCTAGCATGGACGTGAACGGCCGGACTACTGACTGGGAGTACCAAAATCTGGGTACCACCAAGTCGAGCGTTATTGTCAAAACGATGTGAATAG
TTGACAAACGTCAATTTCCCAGCCTTTTCTGCCTGCCTCCCATTCGCCAATATTTTCTCAATACACTACGCTGACTGGCTGAACATGCAGGTCCTGCAAG
ACCTTTACGTACAAACCGGTACTGTAAGGGTTAAAACTCGCGATGAACGATGCATTTAAAACCAATGCAAGGATGATAAGTAATCATTGTGCGGTCTATT
ACATTTTAGTTTGAAATCGGCATGGTTAAAACAGCGCTGCATGCTTGCCCAATTAACACCGGGTTCTGTGTGAAGGCAATCAGGCGGGTCTTGATAACTC
GCTGCGCTATAGCTTGGACTTGTGGCTGGGTCTGCGGAGGCAAGTGCTCTGCGATTGCAGCCGCAGCGTTAGCAGCTATGTCTTGGATGCGCCCGAGGAG
GCTGTCAACCTCCTGCAAGGACTGACGGTAGTTCTTCACCTCGTCATCTTTGACAGGGTCGAAAGGCAGCGTAGCCAGAGACGTGTGCTGGAGACTGTCG
TCGTTGTCGTTGGCTGTGTAGTCGAGATCTCCAGCAACTTCCAGCGTTGCGAAGTCCTGGTCGATGTCGGTGGGAGCGTGGCGTCGGTCGCCCGAAAGCG
CAGCGGACTCAGCGCGAACGGGGTGACTGCGGCCGTCGCTCAGGAGCTAATCCGGGAGCTGGGGCTCATCCAGCGCCGCAATGGCTTGGTCCTGGTCGTC
GAGGACTGGAGAGTCGAAGCCGGCGTAGGTAGTCAAAGCGAACTTTACAAAGTCGGTGAGCTGGATGGACTAACGTGGATTGATAGACTCCATTGCTGCA
GTCGTGCGGGTTGGGGAACGCAGCGAAGCACATGGCGCCGATTACCTCGGTAGATCTGAGCGCGAAGGTCGGGAAACAACTGTCCCCATCGTCGTCGTAA
TTGTATTTAATTTCGAACCCCCCCACGCGTACAAGCGGTACGCGTGGATGAAGATCCGCTTCAAGGCGACGTGTACATGAGTACGTTCCGCCTGCGGTGT
TTAAGGATAAAGCGGTTTCTGTTTGGTCACTGTTACTCAGAATGCGGTAAGTAGTGCCCATGTGCACGTAAAGGAAAAATAGTGTATTTATCAGCCCCAC
ATTATCCTTTATATTTTGATGATTTTCTGATATCGCAAGTTTCCGTAAAACTTTTTTTTACTATTGTTTTCAATACACTGCTATGTGCTTTCAGCTTAAA
TGGTGAATCAAGTTTAACTCCAAATGCTTTGTCGTATATTGATTTTGAGCTATTAAAATGTTCCAACATTTTTAACGATCCCAATGATTAACATAATTTA
TGTTGTCAGTGTGGCTTATACGTACCATCCCAAACATCAGTAGTTTTTTTCAGTGCAAGACGCCAAAAACACTTCACTATTTTTTTTATATATTTTGCAA
TTAATGTTTGCTCGTTTTAGTCTTTGCTTCTTTTCTACACTATCATACTACTACTACTACTACTATTTCCGATGATCCCTCTTTTGTCCTGCTCAAGTTT
TCGCTTGATTAGGATCGTTTGTCCCTCTTAAGAGATTTTTATTATTGAGTTTTTTTAAAGATTATAGATTTGCTGATTCCCGTTTTATTGTGAAAATCAA
CTCATTGCACAGAAGTTATGCATGCAACCTCCCAGAACAAACACTTTTATTAACTCATACCGAAGAATTTTACACGCCAACCCTCATGTTCACGCTACCT
ACTATTTTGAGAGCAACAACGTCGCCATCGGATAAATACTGAGCAATCTGTGACGTCAAAAGCAAACGGGTCAAGTGATATAAAGCGAAGCGGTAAAATG
TACATATTTCATTTAGGAACTACCTAGTGAAAATAACTTATATCTCGTAAGTATTATAGTTGATAAACAAGTACGCTGCTAACACGCGCTTTTTTTAACA
GTAAGAACCATTCTAAAGGCTCAATAAAATACCGTATATGTTCTTTTTTATTTTGCAATATCTTAAAGATATATTTTAATATAAAAAGAACGGTTAAGGA
AGCTTGGTGTGAAACACGCTCGGGTATACCTTATGAAAAGCAATGCCTCCGGCATATTACCCGAGTTCGGAATTGTGAAACTGTCGTTCGGAGTGTGTTC
AGCTTTGGAGAACTTTCTGCTGAGCCAAGACGCTATGCGCACGTTGTCATTGTGGATGGCAGTCACTATGACCTCCTTTGAGCGATGCTCCGGTCATACC
TCATATAACCACTTCACCACCTCAACATGTCCTTCGTCGGCAGCCCATTGCATGGAAAACTTCGAGCCATTTTGCGTCCGATTGGTGTGCAATCATTTCA
CCGCCCGTAATGCGCTGCAACTTTCAAAGTACCTAGTAATGAGCATACCGGGCGTTTGCGGTGGCAGTGAGGTGGTGAGGAACGCCGTACTTCAGAAGAC
CAGCTGGGGCGACGCTTCGTACCTCTCAAATGACAGTGGTGTTGACTTTGCTCGGCGCCCCCGGTTAGGGCTGATTCGTGCAGTGGTTGAAAGTGCACTA
ACGTACTTTCGTGCAGATTCATAAGTCCTTTATTAGGAGGATAGTCCATTCAGAACATCAATTGCGTTTTTCTGCTAAGCTCGATTAAAACTCTTGAAAA
TACAGGCATAACCCCACTAAAACCGGTGCCCGAAAAAGCCCTACCCCCGATAAATATAAGCTAGCTTCACCCCTTCCAACTGAAAACAAGGGCTGATTAT
TTTCCGAGGTTGTTTGTACTCCGTTTCGCCTTCGAAATTGTTTTAGTAGGTGTTATCACGGTTATAATAGAAAGTATGTTTGGAGTAGGCCTTTCGACTA
ATCAGATCGCTTCAAATAGGGGTTATCGATGTTTGGAGTAGGTTTTTCGACCAATCAGATCGCTTCAAATGTATTGTCTGTTTTCACTGGGGCCCGTCTC
TCTCCGCTGAAACCTGCTGGCAAAAAGAGGGAAGTTTGAGTTGGGCACAAAGAATCCAGTTGATTGGCTGATTAAGTAGGCGAAGGTTTGATTCGATTCG
CCAAAACAAATCCGTCGAATAGGAGCATGATAACCGGGTTATCATACCCCCCAGTGTTTTCAGCGAATCAACTCAACTCAAAGGTTCCCAATCACATAAT
GCTCTCATTGGCTAAAATACTTTCTACTTACTGACAGTTGCGAAGCCGTGCCCCATACACCTCATCGGTCTTCAATGATTTGGATATTGAACGCAGTGCG
GACGCTGGCAGCGCCGCCATCTGCACTTCCAGCGTAATTATGACCTCACTTCAACTTCGTAAGTTTTAAATAATAAAATAACAAGAACTTTGCCATAATT
TTACACTTGGAGGCAATAATATTAATGGCCTTTGCGTCCAATCGCCGTGGACATGTGTGGGTAGACAGACCCACGTACTCGTAGATCATTTCCTGCTGCT
GCTTAGTCTCCGTTATACCTCGCCATGAAGTCACCCATGCCTGGGATAATCACCTGTGTCGCTGAATCGACCTTGCTGTCGATAGCACTCGTGATAATCT
GCACACCTGCATGACATGACCGAAGCACGTGAGATCAGTGGCCCCTCCCTCCCTTCCTTTGTAACACCGAGCTGCGTACCTGGGAAGCGGC