Description :
From Genome Similarity Track
Location :
Scaffold_21:3043- 18834
Transcript NameFunction/comments
Phyke_g1345hypothetical protein PHYSODRAFT_477034
Phyke_g1346hypothetical protein PHYSODRAFT_536873
Phyke_g1347putative glycosyl transferase family 48 protein

Sequence
15791 bases(100 bases per row)
ATGCTGCGGCATCTCCATGGTGATGGTGCCCTGGGGCTCGTCGGCGGCGACCTTCACAGCGCTCATGTTCACCTCTTGACTGTTGTTCGTCTCCTTGTTG
TATGAGGGAAAAAGAAGCGGCTGGCATGCCTTGGCAGGTCGCGATTTGCTAAAAATAGCTGAAAACTATCAAAAATAGTCCAATCGTAATACGTCAATCA
TGCCTCAGGTCTTATGCCGAGGGTGCAAACACGTTGAACCTACGAGTCCGCATCGAACGTTGTTAACGATGAGCGAAGCAATAATTGCTTGAATAGCGCG
AATTGAATTGTCGAGAATAAGATGTGCCTGTAAATGCTCTATAATTGTACTATCTGGAAAAAAAACAGTTGAAGAGTGTATGCTCTTAAAGAGTCATCGA
AGAGTGAtgatcacttcaacttgaaagTTGCATTGCGCACTCGCGGCACCAACATGCAGACCCGACGTATCACGACCAAAGCCCCTCTTAAGCAGACCTG
CCAGCTATCTGACACTCCCGACGAAGACGGTAAGTGCGCTAAGTTGAAAACTCGTTGTCTATTGTCCTCTCCGACCAGTGTGCTTTGCTCCATCCAGCTG
GGACGTTTAACAGCGACAAGGTACCAAGAGCGACTTCTCCAATATAAAAGATAACGCTGTGCAAACATCATGAGATCTCGTCCTGATAAAACTGAACGTC
TTCGAATTGCAGGAAAACTCGATAAATGCATCCTCAAAGACATCGAGAGCAGGACGGAAGATCAAACCTACTGGTGCCAAGTGCGTCGACAACACGAGAC
CTACAAAACGACAGAAACTCGGCGCGTCATCGACTCCCCATGACGCCATAAGCCAAGAAACACCACCAACATTTACGTTCAAGGCAGCAAAATCAACATT
CCGCAAGAGAAAACAGCGCAAGCATGAGAAACAACaaaaggaggacgagaagaacaagaaacGGATCAAAGATCTGGTCGCGTACTTCAAGAACTTGGAC
GAGCAGAAACTGGAAACAGCTTGACGTCTCTctcgatgacgatggcggTGTGTTCCACAGCAGGTCGCATCGTGACGGCTACTTTGCTCGTTGTTATTAT
AGCAAAATGAGCCTGTGTGATAACCTCGCTTATGCCGACTGTGCAGTCGCTAACGTCAGCAGCTGGTCGCAATAGCGAGGACTTTGGTGTCGAGTCCGAT
TTTCTTCTGCCTTCTTTGCCAACCGTGGTGCATCGATGGACACCGTTTGCTTGAGAACCTCGAAGACAGCCTCCTACGTAGCATTCGCCCAACCGAACGT
GATCAATCAAAGAGTTAGCAGATGCGTATACGAGATAGTAATGAAGATGGCTGGAAGTTTTCACGCTTTCCTACCTGAATGTCGGGCTCCGAATCATCCA
GATGAACAAACAAGCAGTCTAGAGTGTAGTCGATGATCGTCCCTTGGAAATGCTCCTTCGGTGCGGCACGCAGGAAAGTAGTAAATGTTTGGCACGCTGC
CTTGCGAACTgtgtcgttgctgtcgtccagACGCTTGAGGATTTCTGCGTAGAGCTGATGCACCGGTTCGTCTACCAAAGTAAAACAACAAGCAGAGCAA
TATGTTTCGTGTGAAATGAAAGCCTTTTCAACAAAATTTGGGTGCATATTTGTAGCGTACCTCCCAAGCATCCAGGTAACGCCACGAAAAGGTATTGCAG
CGCAAGACAAACCAGTTGACGGGTTTTGGCATCGCTGTCATCCATAGAAGATTTTAATACAGGCAACATCTACAATCATTGCAAAGCAGGAAATATTAGT
GCATGGACTGCTAAAGAGTTGGGCAGTTAAACAAAGTAGCACAAACCTGAGGCGCAGTTTCAAACAAGCAGGCTTGTTCGGCAATGCCCTGTCGGAGCAA
AGTGTATGCGCATGCAACAGCTACTTTTCTGGTGAATTCAGACACAAACTAAAATATGAGTAATCAATTAAGCGAAGCGCAAACTCTCAGCTGTTGCACC
CACCTGATTGTTGCAGCTACGCGTCCTCCGCGCCAAACGATGTTTGGAATAATTGCTCTCTGAAGCAGATCGACGCTGAATGGTTTAAAAGTCTGAAGAT
GGATGCAAATTTGTGAAGCCAATTAGAGTGACATGCAAGCTTCATGCATATTGAGGCAAGTGCCTAGACGCACCTGGCTGATGGCATCCGTACCAAGCAT
CGTCTCCAGCAATGCAAGGAATGCAAGCCGGACATCCGCATCTTGGTTCGGATCTAAGTGTACCAAGAAGACAGGCACGATTTTCACAAGGTTCTCACCG
CACGCCTGAACAGATAGTAAGATGCAAGTATAGTGATGAGATGTCAAACAACGGCCATTATGCTTTCAGTATGTAAACGTTTGTTCGTACCGCTCCCCCG
CGCCGGCAAAGCGAATCGAACAACACGCGATTCGGGTTGCTTTTCTGCCAACTCGTTCCTGCGTCGACCGGAAGCGCCATCCTATCCAGAAGCTTCCCCA
TGTAGCGTACGTAAAGTGCCTAGATATATTATCATCAGATATTTACTCTCAAGAAGGTAAGAACAATACCAGCATCAATCACATACCTCTAAGGGTTGCT
CCATCTTCGCTGCAAAATCCTCGATTGCTTCGGTCGCCTGATACCATGCATGTTGCAAAATGCGATACAAAGGTCAGCACTTCAACGCAAGGCATCTACC
TCACTAATCGTTGTCATGCATAGCATAGCTAGGGAGTCACCGTTTCATAAGCAAGCGATGACTCGGAAGACGCTGCAAGCAGGTGATTAAGCACCCAGAA
AAGCCTGAAGCTGATTTCGTCCTTCTGGGGGAGCAGCGGGCCGGCAGTCTTGATGATGCTTGAGACGACGCCAGCCAATTGATCCTGTAAATCAGCAACT
TCGGATTCGCGTAGACCAGCGTCGCATAGCGCCTCTGCGATAAGCTACAACGTTCACCGCAGCAAAAGCACAGTGAGCTAGGTATTCGATGTGTAGTGAA
ACACCCAACATTCCTCCCCATAGCAATTTTTACCTCTAAATGAGCTCCGATCGTCTTCGACGTCATGCCTTCGATGCTCATACCTAACAGGATTAATCCA
TTTGTGCGATGTTGCGCTGTGTCCTGCCCTGCTAGTCTACCAGCCACCATCGGCAGCAACGATGCTAGAATCATTTGTGAGTCGGCGTAGAATCCGACAA
CACTCAAGCACGCCTTCACGCCGTTAAGAACaacctcttcatcatcgcgGCAGATCTTGCTCAACGCCGCAAAAACCTTGTCAAGGAATGGGTTCATGCT
CTCCTCCAACAATATCAAGTATGCACTGAGAACTTGCGTATAACGCTCGCGCGCTTGCACAGTCCAATCGCCCGTCTtttcgagcagcagtggtAACACT
TGAGATTGAATGCTACGTGCTAGCCTACGAGCACCAAGCGGAGGTCGCGTATCGAAAAACAGCAGTGGGGCGCCGAGTACAGCACCACTGTCCACATCCA
TTATCTCCACATCGCTTGACGCAACACCTCTATCCTCATCACAAGATTCCCACATGACAGACAACTGATTGAGCTTCGCAAGCGAAAGTATTCGCACCTC
AGGCGCTTCATCCACAATACCAGCCAGGAAAAGTGGAAACAGGGGCGCCTCAAATTGCTGAATCTGCTCGATCTGTGCAAGCCACGAGGACAACGTAACC
ACCAATTGCTTCCTCACGGATGGTGCGTGGTCAAACACGACTTTGTTTATGGATGGTAGCAGCACTTCTTTCATAAGCTCAGGTAGTGCCTCCAAACCGC
AGGGCaccgcagcttcaagtgccTGCAACGCACACACTCGCACGCGACTGTGCTGGTGGCCGAGGTTCATCACAATGGGTTTCACAATAGTCCCAATTTG
CATCGCCATATCACTCTTCCACGTTTTCGAGATCAAAATGACGCACTCTGCAGACATCTTCTTGACGTCGGGGAAAGGATCCACTGCCGTTTTGCCCAGT
GCATTCGCCAATTCCGTGATGACATCACGCAgtgacgtcgtcgtctccttcacagcagcaaattgctTCAGGAATGCATACAAAAGCTGTAGAACCAGCA
GTCGGATCTCCTCCGTAGGCTCCGGGTACGGCAGTTTACCAAGTCGAGCGTTggccaacgccaccagcTCCCGCAACGTCACGTCCGACGGCTCCAGCGC
TCCGTTCTCACATAGAAGCAGCAATGACGTTAGCGCACGCTCTCTGCACTTCTCAACAGTGTCGCTCTCAGCGCATAGCAGCATTGGACGCTGTAGGTTG
GTGGTGCACAAGGCTCGAAGGACTGGTGCAGACACTCGTGACGCCTCGTTCTGTAGCGTGCGGTGAAGCTTGTCGGCTGCACGTCGACGCACACTACGGT
CTGGGTCTGCCAGGCAGTTGACGtcgcgctgcatcttcatggACAGCATGTTGTACGCAGTCTCATCGTCCGGTGACAGCGCCATTTTGCCTAGGTGTCG
GATCTTGGAAATGGAATGCGGCGAccatacaaaaagcaagttCAAAGTACCAAAATTTGGACACTAATTTGGGTAAACAAATGGGCATTACATGCCAATC
AAACGTTGTCTATGGATGTTTCTATGAATACGAATAGATTGCTCCAGTCTTCTGCGCGCTGCTAGTGATGATGTCACGTTCAGCACCTTACTGTGGACAT
TGTCtatttcttcttgccttgCACCCGCTTGCGGCCATTGGCGGTCAGTTCGCGCTTTCGCATACGAATCTTCAACGGGGACACGTCAATcatctcgtcc
tcgccaATGTACGTGACAATATCTTCCAGAGACATAGTGCGAATGGGAGACAGTTTGACGTTTTCGTCCGTACCAGCCGCACGCATAttcgtgagcttct
tctccttcgtaGGGTTAATCTCGATGTCCGTCGGACGGCTGTGCTCTCCAACGATCATACCCTCGTACACTTCGTCACCAGGCTTCACAAACATCTCTCC
GCGGTCTTCCAGCGTGTTAAGCGCGTAGGCCGTGCACTGACCCGGGGCCGAAGAGATCAGCTTACCCTTAGACGGAGGGGTTGCTGAGCCCTGGTACGGC
GAGTACCCGTGGAAAATTGAATTCAGAATGCCACTTCCACGCGTGTCTGTCTTGATCTGTCGATGCACAGCAAAAATCACTAAGGTGAGTACAAGTATAG
GCAGGCACAACGGCACGACGAGAAACGACTACCGGTACGGTAGATACGTACTTCACTGCGGTAGCCCATGAGGCAGCGACTGGGAATCTTGAATTGGAGA
CGGACTTTgtcctgcatctccttgaACTCGATGATCTCACCACCACGAGTCGACAGCTTGTCGATAACTGAACCAGAAAAGTCGGAGTCGACATCAATCG
TCACTTCCTCAATGGGCTCcatcttctgcttggtctcCGGGTCAGTCTGGAAAAGTACCTGAGGAGCTGACACCGACATCTCGAAGCCCTCGCGACGCAT
TTCTTCAATTAGAATAGCAAGCTGAAGTTCGCCACGGCCGTGCACGTCAAACGCTTCCGAGGATGTGCTTTgagagatggagatggcaaCGTTATTTTCG
CACTCGCGttccagacgctgcttgATGTGAGACGACGTGAGGAATTTGCCGTCCTTGCCTGCTGTCGGTGCGTCATTCACACCAAACGTCATGGAAATCG
TAGGCGGATCGAGCTGTGGAGACGGAATGGGCTCCGTCACAGATACATCCGCGATTGTGTCAGACACATACGCATTCACACCAGCAATGGTGACGATGTC
GCCTGGTGCACGGAGTCacaaacaaaacacacaAGGTGAACAGTTAGTTGCGTCCCATAAAGACATAAACACAAATCCCATCCATAACAAACCAGCAGTG
GCCGACGTGATTTCCGACTTGGAAACGCCGCGAGTCACAAACATCTTGGTGACCCTGCCagtctccagcttcttgctctcAAGATTCAGCACTTGGATCG
AGTCACCAATCTACATATACCACCCGAAATCATTGATGTACACTGTTAACATTCGATCGCATGAATACTTTGAGAAAAGAGAGTTGCGCACCTTGACAGT
TCCCGAGTGGATCCGGCCGGTCGCCAAACGGCCGACATACGGGTCAGCGCCAATCATAGTGACAGCCATAGAGAATGGCTtggcagcatcagcatccgGT
GCAGGCACGTAACGCGTGATTTCATCCAGCAAAGCCAACATGCTGTCCTGCGACTCGCTCTTATCCTCAAGGTCGCGCACCGCCCAGCCCTGCTTGGCAG
AGGCGTACAACACAGGGAAGTCAAGCTgatcatcgtcagcatccagcgccacaaacATGTCGAAGAGTTCGTTCTCCACCGATCCGTCCAGACGGCTGGT
GTCACGGTCCACCTTGTTGATGACCACAAGCGGCTTCAGTCCACGGTTGAGCGCCTTGGTCAACACGAACTTGGTCTGCGACATAGGGCCCTCGGTggca
tccaccaccagcaccacaccgTCCACCATACTCAGAATGCGCTCCACCTCGCCGCCGAAGTCAGCGTGCCCGGGGGTGTCCACGATGTTGAGTACATGGC
CGTTGTACTCCACGCGCGTGCACTTGGACATGATGGTGATACCACGCTCGCGCTCCAGGTCAATGGAGTCCATCACACGCTCCTCGGACAGCGTGTTACC
GCCGTGCTTGAGCAGCTGGTCCACTAGTGTCGTCTTGCCGTGGTCGACGTGTGCCACAATGGCCACGTTGCGGATGTTCTCGCCGGTGACGGCCGAGTAG
TCGGTGGAGAATGCACGCGAAAGCCCAGCCACATTGCGCTGCAGAGTGGAGCGTTGTCCAGCGCGCGTACGTGCCAAAGCAGACACACAAGACCGACGGA
GCCACATGCCAATATTGATACGGCAAGTTGATGGGGAACTGCgtgtgtggtggaggagagcACTTGAATGCCAGAAGAGTAGCGTCCCACTCGGTGGTCT
AGATAATGTGCTACATGGTGATGTGGGTCGTCTCACACGTTTCGGTGGTGCGACTTGCGTTCCATCTGATGCCAATCAAACCATTGGAGGACGCTGAAGG
ACTTCAGAGTTCACATTGGCGGTTCTGCAACTTGCGCAATGCAAACTCAAGTTTCATCCGACTCCTTTGAATGTACGGTTGCCAGGCAATGTCATGTCGG
ACCGACTCGGATTCTGGGAATGGTATCTTTGGTTACAGGATGAGCGCGTCACGAGGACACCAGCGAGGTGTGTCACTGTTCTATATTTAGCGGCtggtca
aaacaaaaacCAAGGCAAACAAAGCTAGGGCGGACTGTTATCAGAAAGTCTGAGAGGGCCAAAACGTTTGCTGATCAAATCACATGACTTGCTACGGCAG
TCGCTCGGTGCCCACGCTGTGGAGTCCACATCTTCGCTTGGCATTATAATATGAGCACAGTAGAATCTCTCCACTAAGCTGTAATGCTTCGAGCGGAATA
CAGCTCGTGTGCGAAGGCGGGgttctggtgcttggtgctgcatgGTGCATGATTTCTTCGTGCAAAACGATGCGCAGACTGAGTTTTCGCCGCGGCTTTG
GTGGCTTGGTGGCTACCTTTCCCATGATTTGAATCAAACTGCAACCTGTGGCGCTTTCTATTGGCAGCGATCCTGGCGGCGGGGCTGTCGGATCAAACAC
GCTCCCTTGAGTTTCCCGAGGAAACAGCATCCTGCTGCACACGAAGATCTGCTGGCCCAGTCCCGCAATATAAAAGACATATCTGATTCTGACTCCTCGA
CAGCCAATGGCCACAATAAATCAGGACTGCTGAAGGGTGCcatttcctcttcctcgatgaCAACGGCAATGCTATTAGCATTGCCAACAAACCGTTGGCT
GGTGAGACCTCTGTCCACCGAAGGTCTCACCAGCCATCAAGACAGAGGCCAGCACTGCCGCGACCTTGCCAGGGCCGAATTGTCGCCAATTATGAGAATT
CAACACTGTTTGCGTGCGTGGCGGAGTTCGTATCCGAGGCGAGGGACAAAAGAAGGGAACCGCGGTATCAGCGACCGGGCCTTGGTGCTTGGCGCAATAA
CGAAATGCTTGACTGGTGGCAAGCTGCATCAGCTTGTGGGATACCGTTTCGAAATTGTCACTCGCAGGTCGGGTTTTACATTTTAGAACAAATATATAAA
CCCACCCACCCGATTTTGTTTTACCTTAGTTTTGTAAGTTTGGTGGGTCAGGTTTTCTCAAAGCACGGGTTTCCCCTACTTTCCCAAACCCATTTTCTAC
CCCTTCAACCGTTTTTGTCCTTGCGCATTGACATCTATCTTCCCCCTCATTTGCCCAAGATCTGCTCGCAGACTCATTCCGCATTTTGCGCAAGGCCGGC
GCTGCCTGCCAGAGAAAAGAAAGAGTGCCGAGTCTCGTCCACCATGGCTCTCACTCGCAGGACTAACAGTgcgctactgctgctgctagcCCTGCTACTG
CCCACAGCTGAAGCGTTCATGCCCATCTCCATGGCGCTGCAGCGTGCCAAGCATAACCTCACGGCCTTCCAAACCAAGTGGATCGACCCGGACACGGACC
CCAAATTCTACACCGCATCGATACCTAACGGACCACACAACTTCCCGGACGATGGCGGTGACCCTGATGCGATGTACACGTACGATCTCATCTTCTCGGA
CGAGTTCAACAGCTCCAAGCGCACGTTCGAGGCTGGATTCGACAGCAAGTGGACGGCCATCGACGTCCGCGATACGTCCAACATGGGCCAGCACTACTTC
CTGCCACAGGCTGTGCAGGTCGACAAGGGCAAGCTCATCATCACGACCTCTAAGCCTAAGAAACGCTATCGTGGCACCAAGTACGTCAGCGGCAGTGTGC
AGACTTGGAACAAGTTTTGTTACACCGGTGGCTTTGTGGAAGTGCGAGCAATGCTGCCTGGCAAGTGGGGCGTCCCTGGTACGTGGCCAGCTATCTGGAT
CATGGGAAACCTTGGTCGTGCCGCGTTCTTAGGCTCTCAGGACGGTACTTGGCCATGGAGTTTTGACGTATGTGCTCCCTTTGTGGAGAAGGTCGAGAAG
GTCAAGCAAAAAATCAATGCCTGTGGCAACTTGACCAACAAACATGACAAGGAATCGTACCCGGAGATGTACGGATTGAACCCGTTCCAAGGCCGTGGTG
CGACCGAGATTGATGTCATTGAAGCGCAGATTCGAGCACGCGATGAACCGGCGTACGTCTCGACGTCGTTGCAGATCCGTCCTAGTTTATCTGATGACAT
GCGTCCGCCTTCGGAGAGGCTGCCCAGCCCTGAACAATGGTACCAAGGTCTTAAGTTCGGCAACTTCACTCGAATTAATAGTGACTACTACGGTGAATTG
GGTCTTGACTCCATTTCAGCGCTGACGCAGCTTCAACCTGATGCGTTTAGAGCATACCACTTGTACCGGTTGGATTGGTCGCCAGGTCCGGAAGGATACA
TCCGTTGGTGGATGGATGGAAACTTTATGTTTGAAATCCCTGGATCAGCCTTGAACAAGTGGGTGGGAGATGTGCCTCCTCGCCAGATTCCTGTGGAACC
CAGCTACCTCATTCTGAGTACTGCTGTTTCAGAGAAGTTCTCTCCACCTTGCCAAGGTCAAATTTGTGATTCACTGTGGCCCTCGAACTTCACGATTGAC
TACGTGCGTGTGTACCAGGGTAACCCGAACCGGTACACATCTCTGGGTTGCAACCCCGCGGCATACCCAACGACGGATTGGATCTACGCACACCCGGTGG
ACTTTGGTCTTCCGTGGTATGTCTCACTTCGCGTTGACATCGGTCTCGTGCAGATCTTCGCAATAGCCAATGCATTGGTGGGACTCTTCATTGCGTTCCG
TGGCACGACGCATCCTAAGTTGGCGTCGGCTTATATCAGCACATTGTGGCTCACTGCGTCATTTTATGGAGCTTTGAGTTCGAGCGCCCCAGAAGATCTA
GCTTGGATCCAGGCTGCGATTGCGTGCCTGTGCGGTGTAGTGCTCGGCGGCGTTTGCAGCTTGATGTATCCCATTTCGCTTGGTGCGATGCTCGGCTTGT
ACGGTGGCATCATGATTAGCCAGTTTGTGCCAATATTGTCTTCACGTGTGGTTACTGCTATGCTTGTGGGCGTTGGTATTGCCTTAGGGTGTGTGCCACG
GGTGGACAACAAACACGTTGTTATTCTGTCTACATCGTGGATTGGTAGCCTGGCGTTCTTGCTGTCGATGTCACTGTGGGTGAGCGAAGGTGACATTGTG
GAAAACGTGTGGAGTCTCGCTGGATTTGTCTTCAGCGGGAACGATAACGACCATTTAAGTTTCTGTTCGGAACACTGCTGGGCGATGTATGGACTGCTTG
TTGCGCTTACATCGGTAAGCACCGGTTACGCGTATTATCGTATGCGTGGCGTATCGATGCGTATTGCAGTGCGAAAGACTAAATTTCCGACTGTGTCCGC
TAGCTCAGACGCTCGATCGTGGAGGCCAGAAAATGATGGGGCCTCGGCAACGGGTAAGAGCGATGTGAACTTCTTCTCACCAGCCAAGCTGCCGCACAAC
ATGCAGCAGTTCAGCACTATTTTCCGTATTGCTGTGAACGTGCAGCGCTCGTTTGGCTTCCAGCTTGACAATTTCCGCAACCAGACAGAGCACATCGTGA
TCCTACTCACGAATAACACACGTAGAGGAGGAAATCCGTACAGAAAGCTGCACAATTTGGTGTTCTCGAACTACAGTAACTGGTGCCTAAAGCTGCACAT
CCAACCATTGCAGTGGAGTGAGCAGCGGGCTCCTCAGGGCGGGCTAACCAGTGTCGACGAGATATCCGTGGATTTGTGTCTTTTCTTCTTTATCTGGGGC
GAGTCCGCCAATCTGCGGCACTCACCGGAGTTTTTGTGTTTCCTCTTccacaagatgaaggaggagttCCCGTCGGTTCGTCACACTGAACGCGAGGCTG
GGCACTTTCTGGACACGGTGGTGACACCTGTGTATGGTTTGCTGAGGTCTGAAATGACGTCCAAGTATGATCACGAAGACCGCCACAACTATGACGACTT
CAATGAGTTCTTCTGGACAAAGGCGTGTTTGAAGTTCGACTACAAGCACGAAGAAGTTATTGATCTCACTTCGCCCAACCCAGCCATGATTTATAAACAG
AAGAAGGCTCAGCGTGAGGGCTTGGGAGGCGGGTGTAGTAGTCGAAGTGGCCTCAATGGTGGTGCCAACAGTAACTTCATCCACAAGCGCAAAAGCATTG
CTGAGGGCTTCACAGAGTCGGCGAAGTCGTTCATGGAGAAGCGTACATGGCTAATGCCACTGCGCGCGTTCTATCgcatcttcaacttccatGTTATCTC
ATTTCACTTCTTGGTTGTGCTCGCGTTCGCTAGCGAACAGGAGATGAATCTCGAAGATTCATTAAAGATTGTGGCGAGCGCTTTGATCACGCCGTTTTTG
CTGGACATCCTGCGCGACGGGCTTGATTTATTTGCTGTGTTCGACGAGCACCAGCCAGCGTTCTCGACGACGCGTAATGTTGTGCGTGTGGTTTTCCACC
TGTTGTTGGCAGTGGTTTCTTCAATGTTGTACTGGTATGCATGGACGTATGGTGGCGTGTGGTGGAGTTGGTACTACTCAGTCGTGCTGATTTTCCATGT
GCCGGGTCTGATCAACTGTGCCATGCAAATGATGCCTGGGCTTACAAACTGGACGCGTCGCACTCAATTCACCCCTGTCGCTTTTGTTCGCAATATCATT
AGCCCGATGAACCGATTGTACGTAGGCGATAACGTGTTGGACCCAGAGTCGATGAGTGTGGGGTACCAATTCTTCTGGGTTACGATGCTGTCTTGGAAGC
TGTTCTTTAGCTACAAATTCGAAATCTACCCGCTCGTGATACCGAGTTTATTGCTGTACGCAGATCACGTGGAGAACAAGGTCAGCATAATCACGACTGT
GATTCTCATCTTTATCAACTGGCTGCCGTTCTTCCTGATTTTCTGTGTAGATATCACCATTTGGAACTCCATCTGGATGGCTTTTACGGGCACTTTTGTC
GGCTTCTCGTCTCGCATTGGTGAGATCCGCAATTTCAGCCGTGTTCGCTCAGCATTCAGTCGCTCTGTGGATGCGTTTAATGCAAAGGTGATCTCAGCGA
ACTCGAAGACTGGACTCCAACTTGCGGAAAGTGCGGGGTTGTCATATGGAACAACCTCTGTAGGTCACGAAGTGTTGGATCGCATTGCGGGTGGTGCAGA
TCCGACATCCCGAATCTTGTCTCAACGACGCACTTCTTCGCATGACGATGAGACTCCTCTTTTATCTTTCTCACGCCGTAAGCAGACCCCCCTGGAACGC
CAGGCAGCGCGGCGACGCAAATGGTACTCGTTCTCGGTGGCTTGGAATACTATTATCGATAGTATGCGTGCGGACGACTTGATCTCGAACAAGGAAAAGT
CTCTGCTTCACTTTCATCGTCTGGACGGATATCAACGCGAAATCTATCTGCCGCAGTTTCAGTTGGCTGGCTGTTTCGAAAATTTTACGTCGGACATTCT
GGATATCTACTCGTCGAATGACGGCAATGTGACTGAGCGTGTGCTGCAagacaagctgctggaaatcCTAAGTGAGAGCCCTATGGTGGAAGAATCTCTA
GAAGAAATCTGGGAGCTCGCGAACTGGGTACTCATCAACGTTCTTGGACCGTGTCACTCGAATGACGTGAAATACATTACCAGCGTACTCAGCTCGTGGG
CGTCGCGCGGCGTATTCCGTGCCCTAAATCTGCAGAAGGTGGATTCCTGTGGTCGCGCTTTGGCGGGCTTAgtgtcgctgctgaaaaCAAATGCTCGCAC
CTGGAAGAACGGTGCTAAAGTGATCCCTGTTCGCAAAGATCCGTCTGAGTACGCCTCTTATGAGTTCCCACAGCAGTCAAGCTCATACCgttctgcgtct
tctggtcTTACCAAGTCCGCAAGTACGACGGGTTTGTCTTCTTTGGGTCTTGAACCTCCTCGTCGCAGCCGAGGTTCTGGTGTCGCGCGTATTGCACGTA
tgcaacaacagacacatAAGCCTGCGATTAACAATGGCAAGGCTGCTCACTCTATCCCGAGCTCTCACATTATGCAAATTCGTGAACGCGTCCGAacgtt
cttgaacttgggcAAGGAGATGTTGGCCCATGTCCATGAGCAAGACCCGGTCTACGCTGAAAGCAAGGGTATTTCTGACAGACTCACATGGATTCTTACA
CAAGAGCGTGGTTTCATGTGGGACGACAGCTACACGGGTGAGCAAATTACGCTAACGGCATTTGAAAGCCACACAGAAGTGGTTCTGTCGCACCTGTACG
GGTTGCTCACATTACAGAAGATCGATGCTGAACCACAGTCATTTGACGCGCGCCGCCggctgctgttcttcgtgAACTCGCTGTTTATGGACATGCCTTT
GGCCCCGTTGCTCGAGGAGATGAAGTCATGGAGTGTGATAACGCCATTCTACGCTGAGGATGTCTTGTATTCCAGAAAAGACCTGGAAAGTAAGCAGGAT
GGCCTGGATGTACACACGCTACTATTCCTGCAGACATTGTACAAGAAGGATTGGGAAAATTTCCTGGAGCGAGTgaaacccaagaagaacaTTTGGAAGG
ACCCAGATACAGCCATTGAGTTGCGCATGTGGGCTTCACTGCGCGGTCAGACGCTTACACGCACGGTACAGGGTATGATGTACGGTGAGGCGGCTATTCG
CCTGCTTGCCGATATTGAACAAGTTCCACAACAGAAacttgaagagctgattAACACCAAGTTCACGTACGTCGTGGCGTGCCAGATTTACGGCCGTCAG
AAAAAGAACAACGACCCCAAGGCCAGCGATATCGAATTTTTACTGCACCGGTTCCCGAACCTCCGTGTGGCTTACATCGATGAAGTGCGTGTGAACTACC
AGAAGGAGCAATCGTACTTTTCAGTGCTCATTAaaggaggtgaagaactTGGCTCGGTGCATGAAATCTACCGCGTGCGGCTGCCAGGTAACCCCATCCT
GGGCGAGGGCAAGCCGGAGAACCAGAACTCAGCCATCGTCTTTACTCGTGGTGAGAACCTGCAGACAATCGATATGAACCAGGATGGATATCTTGAGGAA
GGGCTTAAAATGCGCAATTTGTTGGAAGAATTTGACAAGGGTACGGCTGAGCGACCGAATACGATTGTTGGCATCCCGGAGCACATTTTCACGGGCAGCG
TAAGTTCTCTGGCTAACTACATGGCCCTCCAAGAGACATCGTTCGTGACGCTAAGCCAGCGGACGTTGGCACGGCCTTTGCGTATGCGTCTGCACTATGG
CCACCCAGACGTGTTCAATAAgctgttcttcatcacgcGTGGTGGTATTAGCAAAGCCAGCAAAGGTATCAACCTCAGTGAAGATATTTTCGCTGGCTAC
AACAATTGCATGCGAGGTGGTTCTGTGACCTTCCCGGAGTACACGAAGTGTGGTAAGGGGCGTGATGTCGGTATGCAGCAGATTTACAAGTTCGAGGCAA
AGCTAGCGCAAGGTGCTGCCGAGCAATCGCTTTCCCGCGACGTGTATCGAATTAGCCAGCGGTTGGACttcttcaagttgctgtcgtttTACTACAATCA
CGTGGGTTTTTACCTGTCGATGTCCGTCATTATTTGGACGGTGTACATCCTGTTGTATTGCAACCTGCTGCGtgcgctgctctcgttgGAGGGTGTCGGA
GGCCGTGAGCCGGTGTTGCTGAGCCAGTTGCAATTGATGCTGGGATCTGTTGCTTTCCTCACGACGGCACCGCTGTTGGCGACGATCTCGGTCGAGCGTG
GCTTCAAGGCCGCCCTGAACGAAATTGTGGTCCTTTTCGTAACTGGTGGTCCTCTGTACTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTTTGGACA
GACAATTCTTGCGGGTGGTGCCAAGTACCGTGCTACCGGTCGTGGTTTCGTGACGAAGCATTCGTCTTTCGATGAACTCTATCGCTTCTATGCAAGCAGC
CACCTGTATGCTGCTCTGGAGATCGCCATCGGACTTGTCATCTACTATACGTTTACTGTTGGATTTCAGTACTTCGCGATGACCTGGTCGCTGTGGCTTG
TCTTCGTGTCGTGGTACTGGTCTCCATTCTGGTTCAATCCTCTGGCGTTCGAATGGTCTGACGTGATGGAGGACTTCCGGTTGTGGTTCAAGTGGATGCG
GGGTGACGGTGGTAATCCAAATCAATCATGGGAGGCGTGGTTTAAGGAAGAGAACGCGTACTTCTCGACGCTACGTCCTTGGTCCAAGGCGTGTGTCACT
ATTAAGGGTGCGCTGTTCGCGTTTATCGCACTGTCCATCTCGTCCACTGGCGATAAATATCACTCGCTCCTGACGAAATATACGTGGATCCCATTCGCta
tctgctgctccatggCTGCGGTGTATCTGAGTGCTGAGTCGGCAATCTTCTCTTCATCACGCTCCCACGGCGAGAACGGACTTGTTCGATTTTTGAAGCT
TGttttggtgttggtgctgggctCTGGCCTTGTTGTCGCTTTGGTATATGTGGACGGCATGTGGCAGTGCTTGCTGGGTATGGGATAccttgctgcagct
gtgggcTGTTGGGCACTAGTGCTCTTGGGAAGCAACTCGCGTTTCGTTGGAACCCTTTACTTTGTGCATGATGCGGTGTTGGGATTGGTGT