Description :
From Genome Similarity Track
Location :
scaffold_180:30418- 34445
Transcript NameFunction/comments
Pl_108172hypothetical protein PHYSODRAFT_484729
Pl_108173hypothetical protein PHYSODRAFT_326676
Pl_108174conserved hypothetical protein

Sequence
4027 bases(100 bases per row)
GGTCAAACGCTTCCGTTTGAAGATGAGATTCATGGAGCGACTGTGCCCACTCTTGCTCATAGACTAATTTCACGAGGTGTCTGCGAAATGAAGAACGCAG
TATCTTGGTGACCATGGACCTGAACGCTGCGTTCTCGGCGTCTAATGCTGGCTCCACTGCATCCGCGAGACTCTGATAGTAGGTGTTGCTTTCAGCTTTT
GTAGTAGTCTGCGGTGAATGGTACATCCATGTTGTGAGAGCATATCTTGGCTTAGTTGCTGGTATGACACGGTGTAGCATTTGCTGGGACGAGAAAAGCA
CCAATTCACCGAAGCGTGGCTGCACAACGACCCGTGACTTCGGGAACGGATAGAGTACAATTTCGCCTCCATCCCCCTTCGTCCACTCTTCATTCAGGTA
AAGCACAGCAGTCACGCATTTCCCGTCGTCACCATAGGTATCAAAGTGCATCGGGAAGCACGCTCCACGCCCAGCGTTATGCTGCACCTTGACCATGTGT
CCTGTCACCCCCAACCAGTCAGGCAACGCTTGCCGTAGCGGACTGAATACCACTTGATGCTCAAAGAAATCTCGCAGGAACGGCACGGATGTTTGGTCAC
GAATTGCATCTAACGCCAACTCTGTCTCTAGGATGTCGTGTTTCTCCAACAACAGCGTTCTAGTCGTCGATTTGCTCCCAGTACCAGATTCACCTCCTCC
AGCCGCATCATTCAACACGATATGCGTTGAATTCGGGTACAATTGGCCACTTGTGCACAGCCACTTCATTTCGTCGCGCAAATGACGTAGATACTCGACT
GGGAAGGCGTTCGGAACTACATAGTAGCCATCTCGCAGGAGTCCGTTCGCCAATTCAGACGTCACAGATAGATCCCAATTTGCGCCGACCCGGACTTGAG
CTGGGGCGATCGATGAGAACAGGGAACGCGCGCCTAGACAACGGCGCAGCGGCGACCTTGACACCCTCAGCATTTTTCCTTTTGTTTGGCATACTATGCG
ATAGTGTAGTGCGCAGTCAGACACATCCAGGACGATGGCGGAGTTCGTGCCGAGCGGAGTGATCGAGAAGGCATCGCTCCACGATATGATGTATTATTAC
GATGTTGCGCGTGTGTATTGCAGATACATGCACGAGGATTAAATGTTGTCATTTGTATGCAGCTATGCCGCTTGTCCACGATGTTTCACCTCCATGACTT
CCCAATTGGCTTCCAATGCAGGCATGGAGCTGTTGCGTGTGCAATGCTCGTCCTGCAGTACTTACAGTAATGTAGACCAGTTGCAAATTAAGTACCGACT
GAAGGTGAGTACGGACACCTCGATGTTGAAGTGCCTCGTGTGATTGATCGACTCATTTACAATTTTTTTGTTCCCGCTCTCAGCTACAACTTTTGTACGG
ATCGACTGTAGCCGACGCTATGTTGTTTGACGAGGTAGCGGAATCACTGCTCGGTGTCCCAGCCTCCAAGATGAAAAGCGAGATTCTCCCCAAATATCCG
AGCCTGCCTCATGTGCTGGAAGAACTGCTGGTCGGACTACGCGTGTCCTTTTCTTTTCAACGTCCAGCTCCCAAGCGCAACACCAAGCAAATGCAGTTCA
CGGTACGCTGTTACTCACGCTGCGTAGTTGCAAACATTGAATTGAAACTCACAGACGACGCGTATCAACTGCTATATGCTCTTCAGCGTGACCTCAAAGT
CACTAAAATGGATCCGCTCATTCCCCAACTTCTACCGGAGTCAGCAGCCACGTTCGCCATCAACCTGCTGCAACAACGCTCGAGTGGTGGCAATCATCTC
GCCGCGTGAAAACTTGGGGCAATCGCCTCTACGCCTCGATAATTCCAATCGCCAAGGATGGGATGCTCCTTCGACGGTGCGAGAATGCTCTCGTTGAACG
TTGAAGTGGACAGGGAGCTCTCTCTCGACTCGCGATCTCAGCGGCACCTTCCACCTCGGAATCATTGACTCCCCATCCCAATCCACACTCTATTATTTTC
TATCGCGTCGATCTAGTCACGCCAAATTACATTCTGCGCAGCTCGAGACACTAATAGTACAACGCTACACGTTACGTCTCGGTCTCTTCTCATCAATTGG
TTAAAACCCCGTTCAACTTTCATCCAATCGCGACATCACCTTCTTTCCCATTGGACGAAAACCCGTCACTCGCGTTTTTGCTCACCTTCCTCCGACTATC
GAGCAGCCAGAGACCAGGAGCAAGCGTCCGCGGACACTTCCCCGGCGTCTCTCTCCTCTCCAGACCCTCCTCCCGGTATGGCGCACGACCGCGCGGCTGC
TGTGACGACTGCCACGGCACGCGTGGGGCCACCGCTGCTCGTGGCTCGCAACCTGCTGCCATCAGCCACCAGCGTCAACAGCAGCGTCAGCGCTAGCACC
ACGAGCGTCATGAGCTCGTCTTCGTCCTCCTCAGCTACCACGAGCGCCCGAAGCGCGCGACGACGAGATCGCAAGTACGTGGGGGACGATCGAGTGCCTA
CTGCTACGTCATCGTCGACATTGTCCACTGCATCGTCGGTGGACGAGTCGTCCACAATGACAGGAATGTCCGCAGCTGAAGTAGCCAGACGTGCACGACG
GCATACGCATCATAGTCAACCAGATCATAATCTCAAGAATGCGAGACGACGTGGTATCTCTTCTCCACATCGTCATCATAGTCAAAGTCATCAAAGACGT
CCACGGACTAGAGATGCGCCATCTGGAGAATTGGACGTTGCAGCTGCCAATGCGGATATTGGTCCGGAGAAGTTTGCGTCCAAGGTGTTTGCCAAGACAC
ATACAAAGAAGGAGGGCCCGATGGAATCGCCACCTGCGTCGCCGGAGCATTATTCGTCCTCGTCGTCGGGTGGACAGGGAAGTGATAAGGAGGAGACGGC
AGGACTTACGGAACAGCAGAGACAACAGCAATTAGCTATGAAACCTTCGAGAATGGTGGTCAAAAGACGGGCTACAGCGCCTGCGAACAGTAATAGTGCG
CGTCGGACGTCATCAGGACCGACACCAGTGCCATCGTCTCCTGCGAGACAGCCTTCGAGGAGTGTGGGAAAACCAGGTGCGACTAATAGCCCACAGATTA
GTTCTAGTAGTCCTCGTGTTGGTACTAGCAGCAGTCCTGGAAAGACTACGAGCAGCTTGGAGAGATGGCAGATTCGACTGAAGCGATCGGTTTCTGGAAA
TTCTAGCGGTACTGATGATGAACGACAGGGACGGGAGTCGCCGTCGTCGCGACGGTTGTACAGCAATCACCGTAGTCGCCAGCTGATGGAGAGTCCACCT
CCACCAGGTCAGGTAGCAGCAACTAACCGAAGGCGTGGAAGTGATTCACCGTTAATGGATCCGACGAGAACGCGAGCGCGAAGCACGTCACGCGGTTCTA
GGCAACCAGGATCACCGGGAGGGTTGCCACCGCCACCACCGCCCTTATCATTGTCCTCAGACGGACAGGGTTCAACTACTCCTCGGTCTTTGGCACGAAA
AGTTCCGCGCCCTGACGGTGATGCAGAAGATGGCGATGATGCTGCTGCACCAAAACCTCGGCCTGTACGCATTCGATATGAGACCCCAGAACGTGGTATG
GGTGGGAAGCGTGAGATTTCCCACGCATCGTTGGGTAAACTCGTGGCACGCCTCACTGACGCTCATCAGTATGACACAGAATTTCGTGATGTGTTCCTGC
TCACGTACCGGTCCTTCTGTTCACCCTACGATTTCATTAAAAAGCTTCTGAAGCGTTACACAGCAGTGCTGTCGCTTTGCGGGGGTGTGGATGCGGAGAC
AATCGAAGAGACTCAGCGGTTGCTCGACCAAATCACTCTCGAGGAGGAAAATGACCAGCGTTCTTCGAATCTAACGTCAATTTCGACTGCGCTTTCCGAT
ATCAACACAGGAATGGAGGCTAACGTTTCCATCATGAGACTTCTAAGCGTCCTCAAGTTCTGGATCAAGGAAAGTGGGTATATTGACCAAGATTTGGCCA
ACGATCGCAAGGCTCAGAAGAAACTCA