Description :
From Genome Similarity Track
Location :
contig_5:304144- 307965
Transcript NameFunction/comments
g1553.t1hypothetical protein
g1554.t1hypothetical protein
g1555.t1KUF67077.1 Methylglutaconyl-CoA hydratase [Phytophthora nicotianae

Sequence
3821 bases(100 bases per row)
CCGCCGTGCGCCAACGAGAGTTGGTCAGAATAGAAAAACGACGATTGCAGTGACATTGTCGCCGCTACCCCTTTGCAGAGCCTCGTTGACAAGAACTTGC
GCGGCTTGAGATTGCTGGGGGACGGGTATGAATCCCACCATATCCACGACTTCTTGGTCACTAAGAACATCCCAGACGCCGTCGCATCCCAGCACGATAA
AGGGATAGTCCTCCGCCGGTTCAAGTCTGGAGGAAATACATTTTAGAAGGCAGCCGTTGTGACGTCAGATACCATGGTGCAATATTGGCTCTCGGGAGAC
ATCTTTACCTCGTCGCGCTGGTGTGCGGCCTTGCGATCACAACCTGTTTGAGATTTCGGTCTCCGAAGCTCCTGCAATCGATCAGCCCACGTGAGATTGA
GCGCGTTAAACGACAAGACAGTGGGCAGGGCATTACCGGGTAACTGCAAGTACACCAGACACGCGATCTTGAATGACGAAGCCGCCGTGTTGAATAATCC
GCTCCATTTCGTCCTGGTCATTCGCTTTGTGGTCCTGCAGAGCATCAATAACAGCCATGAGCCTCATCGTTGCATAATCAATAAGTATCCTGCTCTACCT
TCGAGAGTCGAACTGCTTTTCCCTTGCAGCTAAGCACAGCCCGACTGCACGAAGCACGCAATACAAGTTAGCACCATTGGCCTGCAGCATCTTACTTTAG
TATCCACGCACCTATCGCCAACATTGGAGACGTAAAGTGTCCTTGCACAATTCTTCTCAAGCAGCAACGCTGTCACAGCCGTGGCGCCCACCGTCCCCGA
AAAAGACTGGCAGCATTCCATGTCGGAGACCAAGTAGCCCCTACACAACGACCACGTCAGTAACAGCACTTATAATACCATCAACAACACCCAGCCAACT
TCAGTCCTTACCGTTCAAGGCGCTGCTCAACTGTGCTTCCATCCTCGGCCAGCTGCAGCTCCGTCGCGATGTTCTTGTGTAGCACTCGTTGCAGGCACGT
CGACACGGAACGACCTACACAGCTCTTGTCAGTTCGTTAATTACGAAACTATCCCTAGATCGCACTATTACTACTAGTATTATAGTAACAGTGCTCCATT
ACCTCCATGTCCATCGTGGATAGCGAAATAGCCGTTCTTCGGGTGCTGCAGGAAGCCATCCACGATGCGGATCGTGTCCTCCATCGTCTTCCTGTGTCCA
GCGTTCTCCACACGACATACGCAACGTCAGCCGACACACTAGCAGCCTCATTGCACATATTAAGCAGGCTATACAACTCACCATTTCCTCGCAGACGCTC
ACGCATCTGCAGCAACTGAAGACCCCGTCCATAATGGAATCCATTGTGTTCAAGCTTAAGTGTATCGAAACGATTGCGCCTTTTCAATTGTGTCCAGTCT
GAGTCGCAGTCCACAAGAAGCGCAGTACCGGCATGAGTCGTCCGCGCGTGAGCATCGCGGCTGTGGCGCTTTCGGCGGTCACGGGCATGACGGCGGCGGC
CGTGTCCATGATGGCGTACTATCGCTTCCAGCACCCGCAGGAGTTCGCGGACGCCAGCATCCGCATGACGCACCCGGAGGTGTCGGACGATTTCAACCGC
AGATGGGGCCTCTTCGGCACGGGCGTCATCGACTCGGTGCCGCAGAGCATCAAGGACGTGTTTGACGTGCCCGACATGGCCGAGCGCTTCGAAAAACACA
AGAAGAAACGCGAGGAGCAGATCCACCAGATCGTCGAGGACCTGCGCCCCAAGGGCAAATAGACGGGCAGCCATAATTTCTACTGGCAATTGGACTACGA
CGGAGACAGAAGACGCGTAAGACAGACCGAATCAAAAATAACAATTAAACACCGAGTCTCGGCAGCAAAGTCGCATGTATTCAACTTGTTCTTGTGGCTC
TCATCAGCCAAAATGCAGCGAGTCTCCAGAGAGCTAACGCTACACTTACGAGCGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGGCGG
AACGAGGAGCCGATGATCTTGTTGGCACGGTGGCCACGCTTGCGGAGGCCACGGCCCTGGCGGCCGGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGT
GCACGGCGTTGGCGATCCAGTTGATGCGCGGGTCGCGACGGATGACCTTGTGCGAGTGGTCGACCATGATGATCTCGAAATACTTGTACGTAGCGTCCTG
GTTCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGGCACGCTCCTCAGCCACCGAACGCAGGTTGCGCTCGAACTTGAGCTCGTTG
ATACCGTGGTGCTTGGGCTTTCCGTACACGATACCCTTCGAGTTCGGGCGCTTGCGGCCACCGCGACGCACGGCGACGCGCACAATGACGAAGCCCTGCT
TGGCCTTGTAACCAAGACGGCGAGCCTTGTCCACGCGGGTGGGGCCCGTCACGCGGTGGATGACCGGCAGCTGGCGGTACTCCCAGGCGCGCACACGCAG
CAGGAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGTACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAAGGAAATGCTCCGA
CATATTGGGCCACCAGCCCAGGAACGTACCAGCCCCAGCCAGTCATTCACACCAACGGTCCCGCTAAGTACGACCGAGGTTAAAATGGGATGAGTCAATA
AAACCTTGTTCGTATTTAAACAGGATGTTTCGTGTACCCCACACTACGACTGCTTGAAGTTGGCGCTCCGGATATTCGTTGTCGTCTTCATGGTGTTCAC
GACGATGCTGTTGCGCACTACCGCAGCTCTGCAGCAGACCGGCGGCCGCTGGATGAGCGCGGCGGCTACGACGGCCACGCAATTCAAGCTGGAGATGCTG
GGCGGCAAGGACGCGGGCATCGCGCTCTTCACCATGGACCGCCCCGAGACGCGCAACGCTCTCGGCCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGG
ACCAGGTACGCTACGACCCCAAGGTCCGCGTGGTAATCGTGCGCAGTGTTGTGCCCAAAGTCTTTTGCGCCGGTGCAGATCTGAAGGAGCGTCTAGGCAT
GTCGCCTCCGGAGGTACGACGACTCTATAGTTTGCGCATGCAGGGAGGTGTTGACTGGGGAGTGATATTGCAGGCTGCCGCTTCCTCCCGTGGCTATCGC
ACGGGATTCACCGACTTGGAGCAACTTCCGATGCCGACGATCGCCGCTATTGAAGGAGCTGCACTTGGCGGTGGCATGGAGATGGCGCTGGCGTGCGATC
TCCGCATCGCTGGCGCTAAAGCCATCCTTGGGTTTCCAGAGACGTCTCTGGCCATTCTACCTGGAGCAGGAGGCACCCAACGCGCGTCTCGCCTCATTGG
TATGGCCACCAACTTTTTGTCGTCCTTGCTCTTAATTGTTGTACATGTACTCATCGTATCATCCTCGCTCTTGCCCCGCAGGCATCTCGAAGGCCAAGGA
GCTCATCTTTACGAGCCGCCGCCTCAACTCGGAGGCTGCTGAGAAGGTCGGTTTGGCCGACTACGCCGTGCCTGAAGGTAAGGCCTACGACAAGGCGCTC
GAGATCGCGCGTGAGATTCTCCCCAACGGACCTGTCGGCGTCCGCATGGCCAAGGAGGCGATCATGAGGGGCTCTGAAGTGGACATTGCTACGGGTATGG
CTATCGAGAACGCTTGCTACGCGCAGGTGATCCCGACCAAGGACCGCATCGAAGGTCTCGTCGCTTTCAAGGAGAAACGTAAGCCGCAGTACAAGGGCGA
GTAAGGCCGATCCGTCGCCTT