Description :
From Genome Similarity Track
Location :
contig_5:304110- 307931
Transcript NameFunction/comments
g1675.t1hypothetical protein
g1676.t1hypothetical protein
g1677.t1hypothetical protein
g1678.t1hypothetical protein

Sequence
3821 bases(100 bases per row)
CCGCCGTGCGCCAACGAGAGTTGGTCAGAATAGAAAAACGACGATTGCAGTGACATTGTCGCCGCTACCCCTTTGCAGAGCCTCGTTGACAAGAACTTGC
GCGGCTTGAGATTGCTGGGGGACGGGTATGAATCCCACCATATCCACGACTTCTTGGTCACTAAGAACATCCCAGACGCCGTCGCATCCCAGCACGATAA
AGGGATAGTCCTCCGCCGGTTCAAGTCTGGAGGAAATACATTTTAGAAGGCAGCCGTTGCGACGTCAGATACCATGGTGCAATATTGGCTCTCGGGAGAT
ATCTTTACCTCGTCGCGCTGGTGTGCGGCCTTGCGATCACAACCTGTTTGAGATTTCGGTCTCCGAAGCTCCTGCAATCGATCAGCCCACGTGAGATTGA
GCGCGTTAAACGACAAGACAGTGGGCAGGGCATTACCGGGTAACTGCAAGTACACCAGACACGCGATCTTGAATGACGAAGCCGCCGTGTTGAATAATCC
GCTCCATTTCGTCCTGGTCATTCGCTTTGTGGTCCTGCAGAGCATCAATAACAGCCATGAGCCTCATCGTTGCATAATCAATAAGTATCCTGCTCTACCT
TCGAGAGTCGAACTGCTTTTCCCTTGCAGCTAAGCACAGCCCGACTGCACGAAGCACGCCATACAAGTTAGCACCATTGGCCTGCAGCATCTTACTTTAG
TATCCACGCACCTATCGCCAACATTGGAGACGTAAAGTGTCCTTGCACAATTCTTCTCAAGCAGCAACGCTGTCACAGCCGTGGCGCCCACCGTCCCCGA
AAAAGACTGGCAGCATTCCATGTCGGAGACCAAGTAGCCCCTACACAACGACCACGTCAGTAACAGCACTTATAATACCATCAACAACACCCAGCCAACT
TCAGTCCTTACCGTTCAAGGCGCTGCTCAACTGTGCTTCCATCCTCGGCCAGCTGCAGCTCCGTCGCGATGTTCTTGTGTAGCACTCGTTGCAGGCACGT
CGACACGGAACGACCTACACAGCTCTTGTCAGTTCGTTAATTACGAAACTATCCCTAGATCGCACTATTACTACTAGTATTATAGTAACAGTGCTCCATT
ACCTCCATGTCCATCGTGGATAGCGAAATAGCCGTTCTTCGGGTGCTGCAGGAAGCCATCCACGATGCGGATCGTGTCCTCCATCGTCTTCCTGTGTCCA
GCGTTCTCCACACGACATACGCAACGTCAGCCGACACACTAGCAGCCTCATTGCACATATTAAGCAGGCTATACAACTCACCATTTCCTCGCAGACGCTC
ACGCATCTGCAGCAACTGAAGACCCCGTCCATAATGGAATCGATTCTGTTCAAGCTTAAGTGTATCGAAACGATTGCGCCTTTTCAATTGTGTCCAGTCT
GAGTCGCAGTCCACAAGAAGCGCAGTACCGGTATGAGTCGTCCGCGCGTGAGCATCGCGGCTGTGGCGCTTTCGGCGGTCACGGGCATGACGGCGGCGGC
CGTGTCCATGATGGCGTACTATCGCTTCCAGCACCCGCAGGAGTTCGCGGACGCCAGCATCCGCATGACGCACCCGGAGGTGTCGGACGATTTCAACCGC
AGATGGGGCCTCTTCGGCACGGGCGTCATCGACTCGGTGCCGCAGAGCATCAAGGACGTGTTTGACGTGCCCGACATGGCCGAGCGCTTCGAAAAACACA
AGAAGAAACGCGAGGAGCAGATCCACCAGATCGTCGAGGACCTGCGCCCCAAGGGCAAATAGACGGGCAGCCATAATTTCTACTGGCAATTGGACTACGA
TGGAGACAGAAGACGCGTAAGACAGACCGAATCAAAAATAACAATTAAACACCGAGTCTCGGCAGCAAAGTCGCATGTATTCAACTTGTTCTTGTGGCTC
TCATCAGCCAAAATGCAGCGAGTCTCCAGAGAGCTAACGCTACACTTACGAGCGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGGCGG
AACGACGAGCCGATGATCTTGTTGGCACGGTGGCCACGCTTGCGGAGGCCACGGCCCTGGCGGCCGGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGT
GCACGGCGTTGGCGATCCAGTTGATGCGCGGGTCGCGACGGATGACCTTGTGCGAGTGGTCGACCATGATGATCTCGAAATACTTGTACGTAGCGTCCTG
GTTCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGGCACGCTCCTCAGCCACCGAACGCAGGTTGCGCTCGAACTTGAGCTCGTTG
ATACCGTGGTGCTTGGGCTTTCCGTACACGATACCCTTCGAGTTCGGGCGCTTGCGGCCACCGCGACGCACGGCGACGCGCACAATGACGAAGCCCTGCT
TGGCCTTGTAACCAAGGCGGCGAGCCTTGTCCACGCGGGTGGGGCCCGTCACGCGGTGGATGACCGGCAGCTGGCGGTACTCCCAGGCGCGCACACGCAG
CAGGAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGTACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAAGGAAATGCTCCGA
CATATTGGGCCACCAGGCCAGGAACGTGCCAGCCCCAGCCAGTCATTCACACCAACGGTCCCGCTAAGTACGACCGAGGTTAAAATGGGATGAGTCAATA
AAACCTTGTTCGTATTTAAACAGGATGTTTCGTGTACCCCACACTACGACTGCTTGAAGTTGGCGCTCCGGATATTCGTTGTCGTCTTCATGGTGTTCAC
GACGATGCTGTTGCGCACTACCGCAGCTCTGCAGCAGACCGGCGGCCGCTGGATGAGCGCGGCGGCTACGACGGCCACGCAATTCAAGCTGGAGATGCTG
GGCGGCAAGGACGCGGGCATCGCGCTCTTCACCATGGACCGCCCCGAGACGCGCAACGCTCTCGGCCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGG
ACCAGGTACGCTACGACCCCAAGGTCCGCGTGGTAATCGTGCGCAGTGTTGTGCCCAAAGTCTTTTGCGCCGGTGCAGATCTGAAGGAGCGTCTAGGCAT
GTCGCCTCCGGAGGTACGACGACTCTATAGCTTGCGCATGCAGGGAGGTGTTGACTGGGGCGTGATACTGCAGGCTGCCGCTTCCTCCCGTGGCTATCGC
ACGGGATTCACCGACTTGGAGCAACTTCCGATGCCGACGATCGCCGCTATTGAAGGAGCTGCACTTGGCGGTGGCATGGAGATGGCGCTGGCGTGCGATC
TCCGCATCGCTGGCGCTAAAGCCATCCTTGGGTTTCCAGAGACGTCTCTGGCCATTCTACCTGGAGCAGGAGGCACCCAACGCGCGTCTCGCCTCATTGG
TATGGCCACCAACTTTTTGTCGTCCTTGCTCTTAATTGTTGTACATGTACTCATCGTATCATCCTCGCTCTTGCCCCGCAGGCATCTCGAAGGCCAAGGA
GCTCATCTTTACGAGCCGCCGCCTCAACTCGGAGGCTGCTGAGAAGGTCGGTTTGGCCGACTACGCCGTGCCTGAAGGTAAGGCCTACGACAAGGCGCTC
GAGATCGCGCGTGAGATTCTCCCCAACGGACCTGTCGGCGTCCGCATGGCCAAGGAGGCGATCATGAGGGGCTCTGAAGTGGACATTGCTACGGGTATGG
CTATCGAGAACGCTTGCTACGCGCAGGTGATCCCGACCAAGGACCGCATCGAAGGTCTCGTCGCTTTCAAGGAGAAACGTAAGCCGCAGTACAAGGGCGA
GTAAGGCCGATCCGTCGCCTT