Description :
From Genome Similarity Track
Location :
Scaffold_600:3041- 11216
Transcript NameFunction/comments
Phyag_g6934hypothetical protein PHYSODRAFT_547717

Sequence
8175 bases(100 bases per row)
GGTTGAGGTTGACTAGACGATGTCCATGATGAGAGCAACGCCAGCTAAGACCCAACGAGCAGGTGGTgacttggacttgagctGCGCTGAGAAGACGTAG
GTGGGTCCGCGGAACTCGGTCTTGTAACATGGACAGACGTACGATCCCTTGACGTCGAGTTTGTCGGCGGCCACCGCCTTGCAGTTGATGACAGGCATGG
GCGAGAACATTTCCTTGGGGTGCGACCGATCCACCGTGTTGTTCTGGATGTCCCAACGCGCGCCCATGAGGAACAAGCCGTGGATGTAGGCTCCGTCGCG
AGATGGAGCGTCCACTTCGCCATTGCGGCGCTTGAGTACATCCGTCTGAATCACGAGCTTGTCGAGTTCCCATTGATTCTTCTGTGCCGTGACCTGCATG
ATGGCCGTCAAGAACGACTGCGGGTTGATCATGCCGGAGAGCCACGTGACGCGCGGGATGTCCGCCGGGTTCTGTGTCCActcctccagttgctgcagtc
tcgCCTCGAGGTTTGTAAGCCACGACCCAAGTGGCCGCATGGACGGGAACGCCAACTTCTCCCACGACTTGGGCACGCGGTCTAGGAACAGCGACTCCTG
TACAGCCTCCATGGCGTCCGACATGGTGAGCTCACCGGCGAAACCAAGCGACAACTCGTTCAGCGAGCGCACGACTTCCGCCAACAACCCGTTCATGGCC
TCACACTCCTGGATGAACACGTTCTGGTACGGTCCCATCTCTTCCAGGTTACGAGCGATCTCATCGCactcgaacttcttctcaCCCACACGAGACAGCA
CCATCTCCAGACCTTGCTTTGCTAATTCTAGTGGACTCATAGCAGCGTCGCCCGCTGCGGCATCtcgaggctgcagctccatcaacgtCCGGAACAAATT
CTCTGATTGCGTCGTGCGGAAGTCGATCTCAGCGTTCGGGTGTAGTCCAAAAGCCAATGGTGAGTCCGTCTTGAGCTCCGTCTCAATGTGCTCTAGGTAT
TTGTCGTAGGAAGACGGAGCGAGACACATGAAAGACGGacccttctcgtcgccgacGAACGGGAACAtttccatctcgtccagcaactcgTCACGCATGA
AGAAGTCCAGGTACGTGTTGGCTAGCAACCGATCGAAGTCGTTCACAATGTGGCCACCGTACATGATCTCGCCGAAGATGTAGCGCAGATCGGCCCACGG
GATTTTTCCACCAGCCGAGCTTTCAAGATAGTTCTGCAAACAGATCGCCGAGTCACGCAAGTCGCCGAGCGAGAACGGATACATCATGTTGAAGCCCAAA
GGACCGTACATCTTGCGCTCCATGAGCACGGCGTGGAAGTGGCAAAGCCCAAAGAGAATGGACTTGACTTTGCCTTCAGCCTCCTCAATGTACTCCTTTG
GGAAGCTCACGAACGCTCGCTTGAGGTTGGCCTTGAGACCAGACGGCGGTTCGTTCGTCAGCTTGATGCAGCGGTTGAGAACGCCGATGGGGATGGAGTT
CGACGGGTCCGACGTCAGGAACAAGCGGAAGTTCTTGTGCGAGCCTTCCAGCGCGAACTcatccagcttcttctccagcgccaacagccAGCGCGGCATC
AGGTGAATGTTGTTGAGGATGACCCAGTGGCCATTTCGGTGCGCAACCTCGAGTCGATCCATAGCGTACACATCCTGACCCTGGCCCATTGACACGTTGT
GGTAGCTTACACCACGTTCGAAGCCGTACTTGACACTGAGCTTGTCCACTCCAGCCACCACATCGGCACCCGGAGACAGGATGAAGTACAATGgcgttgt
tggcgtcgaaTCCAAGTACGAGTTTTCCATTACCTGCAACGCGTTTAGAGCCGAGTCACAATCGCAGTAGTTGCTTCCGTTAGGAAGTACCTGCCGCACG
AACTCGTTCACAGCCACCGTCATTCGATCTGGGCGCAGACAgcgcaccaccagaagcttCAGGAATGGCGTACGGTCAAGACCTGCCCAGTCTAGCGGTA
GCTTCTCGGACTCCGGAGTCACGTGGTTGTACCATTCGCGAAACCGCGAGGACGCCTCCTTCAGGTCCTGCGGCATCTTCTggaactcctccagctgaGC
CAGCATGTTAATGGCACTCCACTGAGCTGGTGGCAACCAGTCAATGGGgttcccttcttcttcgcctccacctgctgcttgcttCTTTGGTCCGCGCAAC
AGGAACTGCATGTAGGCCTCTTGCACTCGGACGTCCTCGCCCAAAATGCCACGGCGCATGAGATTGAATGTGAGCTGAGAGAGGAAAATGAGCTTGTGCG
CCTCGAACAGGCCGCGAGATACCCACGTGTAGATGGTGATCCGCAACGACTCGCGCAGGTTTAGTACTCGCTCACCCTGCTTGTCACTCTGCAACGCTCG
ATCGATCGAGTTGTagaagaaggtgatgaaCGAGTCCAGACTGTAGCGGTACATGTGGTCGATGGCACTGAGCGTCGTGAGCAAGAAATAGAGCATGGCA
CCCTCCGCTGCCACCGGACGATATAGCTCTCGGGTGTTGTTGATAACAATCTCCGTCTcctggttcttcttgactgAAATGGAGATATCCGTCGCTTTCT
TCTTAGTCTCCTCCAGACTCTCAATCAGAGGCACGTCGCTCAGGATATCATCGGGTGCATTTGCAAGACGCTCCAGGAGCTgatcctccagctccacaag
ATCGATCTTAAATTTCTGGAATGCCAACACAAGCTCTTGCTTCCGAGCCTCAAGCTCCggctgctccttcttgaccaccttctccagcaattgGTCCTCC
AGTCCGCTTTCGGTAGCGATGAAGTTGATCAGCGTGCACTGAGCAGCGATCTCGGGCTTGTAGTGCGGgttcgacagcttcgtctgCAGGTACATGAAGA
AGTTGGGGTCGTACTGTACTTCTTCACCGGCCAGCTTCAAGAAGAGGTTCGAGCCCTTCTTGTACACGGCACGTCCAAGCACCGGGTCCAGCGTGGCATC
GATCTCCTCGCCAATGTTTTCAATAATGAGCACATGGCCATTTACGATAGCTGTCTCGGTCTTGCGTAGCCACTGGTTctggctcagctgcagcactaca
AGGCCGCGgtctttctccttctcacgGAGCCACTTAATACCCTGCAGTTGCGGGTCAATCACCAACGGCCAACGTTTGCAACTCGTGATAATGGCGCCGT
TCTCGATGGAAATCCGATCTGCCGGTAGCCCCTCGCTCATCATTTTAGCGTTCTTGCCTTCAGTCGTCAGCATGGACAGCGGATCAATTCCTTCCGTGAT
AGGGATGCCCTTGGCCACTAGGTCTGGGAACCATGTTTGCTGCCACAGTTCCTTGCGCACGGCTTGATCGAAGGCCCCGATGTAGGacacgaaagcagca
gccaacagCGAGTTGCCAACCACCATGACGCCTGAATTCTTGAGCTGTTCGATCTCAATACCCCACCGCTCGTTCTCACTGGCCAAACCATTCACAAGTT
TACCAGCCAACAGCAGTCGGTTCTCACACGACTCtttcatctcctccaccttcagcttctcctccgtaGCTTGACGCAGCGTGTTTTCAAGTGCCTCCAG
CCGCTTCTGCACCTCCGCCACTTGACCCATCGCCCGTGCGAGCTGCTCCTCggcttcctctttcttcttcttggaagcCTCGAGTGAATCCATGAGAGGC
TTCACGCGCACGTAGATGCGATTGAACGTGTAGATATTGACGACCCACGAGCAAATGTTAGCAGCGGCCGAACTCTTGGAGGCCATCTTCTCAGCTGTGA
ACTCAGGATCCGCGATCAAAGGTTCAATACGTGCAATGTCCGCCTCGGGGATGTCTTCGCCTTTAAAGTCCTTCAGTGCATCTAGGAACGCACCAGCGTT
GTTCATCATTTTCTTGGCACGATCCCATTTGTGGTTCTTgtactccttctccaccaagaTCAGGCACGCCTTTGTGACGTTGTCCACGCCGGCAGGTGGC
TTGGGTAGACTCTTGAGCTCCGTAATGGCGGGCTTCGACAGACaatcgacggcagcagcggcagcgtccATGGCGGGTTTCGCTTGACTCAGCTCCTTTT
CTGCTTCAGCGGCGAGctctgctgccgctgcactgGCCGCTTCggccttgagcttctccttgttggcgttctcctgctgcactTCGGCTCCTGCCTTTTC
CCTTCCCATTTGTTCCAGTAGCTGATCCGTCGAGGCTTGCTTCTCAGCGACCTTGACCATCGTGTGTTTTAGATCAACCTGCAGTTCTGCCACGTCCGCC
GACGTCTTCCGTAGCGTCGAGAGTCCATCGTCAAGACGGGAAATTTGACGTTGGATGTCCTCCTTCCGCTGCTTGAGCAGGATCTCGTAGAAGCTGATGA
GCTCCAGGAAACTCTTGGGCGTCACGTAGTTGTATCGTCGCTGGGTCTCGAAGTAGTTCTTGCTCATGTCCGTCACCGAAATGTGCACGTCGGCCATGTG
GTTGGCCAGGTTCCGTTGAAGAGTAGCGTCGCCCACgtcctcgaacttctccagaaAGCTGGATGCAACACGCACCAAGGCATCACGGGGCCACGGGTGG
AACCAGTCGATGACTGTGCAATTCACGAGACCCGGGAATCGACGAGCGCGAACACGGAAGACGGCACCAACAGGAGAGAAGCACATGACAACTCGGAAAT
TGAGTCGAATTCGCAGCAACAGAAAGTCCATGAGGGCGTCCATGGCATCAGGAATGCCGTTCGCCTTGGCTTCGCTACGTAGTGAGCCCAGAAGTCCATC
GAGATCTTCTTTCGGGAAGAGATCGGGGATCCAGCCGGACGATAGCATGTCGTTGATGTACACGAGGAACCGCTCGTTCACGATCTGCGAGTCGGTGATA
AGGAAGACGAGCGGCAGACCCTGCACACCTGCTATTTTGAACATCTCGGCCAGACTCTCCTTCAGGTCTTCGATACGGAAGTTCGACGTGACGGACAGCT
GACGCACATCAAAGCCGCAGATGTGAGACGCCAAGCGTGACAGAGACTGCTTGCCACTTCCACCCACTCCAATAAGCATCGCGTTGCCTCCAGGGTTTCC
GATGATACGGCAGATTCGCGTCACGTGTTCCATAGCGTTGTCGAACAGTTCCAGGTTCATCATGGAGTACTTGGAGTTGTAGTCGTCGAGCTGTTCCACC
AAAACCTTGTTGAGCGCCTTCATTGAGGCCACGGGCATGTACACGCTGTCAGCACCAGCCACTGGCGTTGCAAACGTCGTGAAAATATTCACCGGCACCG
GCGCACTGTCCTCCGCGccaggagctggcggaggctGGTCATTGAAGAGCGCCACCTGATCCAAGTCTGGTAGCGTTTTCTTAGTCACCTCACGAATGCG
GTCGCCAAACTTGAGAATGTCCTCATCGTTGATAAGACGATCGCAGAACACGCGAGTAGCTTCGTGCACCCACAGTCGCGCAAACGAGAAGGCGGTGGGG
AAGAACTCGCCCTTGGACCGAGTGAGACCCTGGAAAATGTTAGAGAGTTCACGCATGTTCCAGTTGTAGACGAACTTAGTGGCGCTCGGAAGGAACCGAT
TGGCCATCTCTTCATGCAGCAGAATCGACACGTTGACGATGTTCTCGCACACTGTCACCACTGGCGGAGCGAAGCCTGAATTCTGCATGTGGCCCTTAAG
GATCGAATTGTAGATGGTCTTGAGGTCCTCTCGGCCAGGCATCATGCATGCGAACAGAGCGTAGTGCCGCTGCAAACGCTCGTCGATGATGAAGGAACCA
GCAGTCGGGTTCATAGCCGACAAGTACTGGACGTCGACGATCTCCTTGCGGAAGCCCAAATCCACTCTATCGAAGAAGGTTTTGTAGTCCATGTGCTGCC
GCAACAAAGCCAGCGAGTTCTGCGTGCCATACGTTTCGATGTAGGGCAAATtcaagtcgtcgatgaagtagatcaacttcttcgtggcGGGAGGACCGAA
CATGCGACCCGAGCGCTTGTCAATCACcgactcgagctgctgctgcagcttggccgaGTCGGTGTAGTAGTTCATGTTGATATTCGAGAAgagcatgtcg
tcgtcgagatcgCGCAGGAAGTTTTTGAGGATTGTGGTTTTCCCTGTACCGCTGCCACCGACAAGCATCGCAGGCCGTTGTCTCGCCACGAGGGTTTCCA
CAAGGAAGCGAATACGCACCGAGTCGTTTGTACTGATAACGATAGAGTTGAACGGCGTGTCTGCCGGTCCATTTCCGATAGAGCCCGGCAAGTACTTTGG
CACCTTGGTGCTCCAGCTCTCGAATTCGCCCGACTCAAGATTGTAGAAGTAGTCGAAGCACAGACCCTCCTTCGGGTACTTGATGTTCGTGAATGTGGAG
CACCAAAGTTCGTGGAAGTTCTTACGGTAGTCGATGCTCTTGTCGACGATGAGCGGGCCACCAAACGCCCACGTCGCGCAGAAGACAAAGATCGACTCGA
TCACCtccgggttcttcttctccatcgggATGTTCCCCAGAAGACCCTCGAGCAAGTAACAAATCGTCGACACCTGGTTGATAAGACGCACAGGCGCCAC
TTGCTTGTAGCCCTTCCTCATCAGATCGTAGATCGGGTCCACATACTTGTCAAATAGTCCAGGCAGATACGTGCGCTCGACTTCTTCctcgcgcttggcc
accCACGACTCCATGAATGGCCGCCAACCGATGTCGATCTCATTGATGAAGAGAATACCTGCCCGAGAGACTGTAGCGGGGGTAGCGTTCTTGAGTGAGT
TGATCTCAAAGACCATCCGCATGGCGCTACTCAGCGGGATGCGTTCGTTCGACACCAACGTCAGCAccttgttgtcgtccatgacggTGTTCATGGACTC
AATCCACACGGCGTCAATATCGCCGTCGAGCACCACCCACTTGTACGTTTGACTCTCGTAGAACCCCTGCTCGGAGTAGTTCTTGGCCATGCCACGCATG
ATGATCGACAGCACACCGTCCTTCCAGTCTTTCGACAGAGTCATGTAACCATAAAGTTCGTCCGATGTGACGGCCTTCGGGTTGAGCGTCTCGTACACGC
agatcttcttctctttaCCGAGGTTCCAGCATTTTGCGAGAGCCTGCCATGTCGTGGTCTTGGCACAGCCTGCAGGACCGAGCAGCATGACGGAGTGCCG
CACGTCGATCAGTTCTTGCAGCTGACAGATCTTAAGAATGAACgagtcgtcgtgctgcaagTTGTTGGCCTTGCACACTGTCACAGCCTTCTCTCGCAGC
TCCACGTTAACTTTTGGAGCCACCTCAACACCGATGAACAGGTCGTTGATGAGGCGGAGGAAGATCGGCGTGTCGTGGTGGGGGATTTTTGGCGTGTTGA
AATCACGCAGTGCACGCATCAGcaccttgtcctcctcgacgTCCGGCTCGGCTCTCTTCAGAATACCAGCCACACGGAGCACCGACTTGACAGCACGGAG
ACCCCAATCGTAGTGGAACTGCTTAGACAGCAACTCGCCACTCAGCTCGTACAGCGTCACGAACTTGATAGCCAGCGTTCGGGCCTGCTGGAAACCTTCG
GACATGAGCATGTTCTCGCAAATGGGCTTCAAGTCAGGTCGAATCATAGCACACGAGCGGAAAAGCACCTTCAGGTTCTCTGGTAGCTCCGTACGACCAG
CGTAACCAGGATTcatcgtgatgaagaagccgcaTGTCGGGATGAGCGTGATTCGATCCGATGTCCCCATGAATTCGAACTCGCCCACAACAACCGGTGG
GGTGCCTGCAGGAAGCGACTGGTACTTCGCCTCTCGGTTGGCTGGGACAGCGTTATACACGATGGCATCCTGGATGCACTTGACCTGAGTGGCCACCACA
CTCAGCACCTCGATGTTGATCCGGTTGAACTCATCGAAACAGCCCCATGTTCCTGTTTGACATAAACCACGGAAAATGTCGGCCATTGTCTGGTAATTCA
TCTGATCCGAGCAGTTGAACACGTAGCAACACAGCGCCATGGCACGAGCCAAATCTTTTGTTGTCTCGGTCTTGCCAGttccagcaggtccagcaGGAGC
ACCTCCCAAGAACAGTCGCAATGCCATCGTCAGTGTGATGTAGCATCGGTCTGTAAGCGGCGTGATAACGAGACG