Description :
From Genome Similarity Track
Location :
Scaffold_412:3041- 4866
Sequence
1825 bases(100 bases per row)
CTCGACCTCGCGAGTGGATACCACCAAATGCGCATGTCTCCGACGTCAAAACAGTGCACGGCATTCAGGATGAACCATGAGATCTATCATTGAAACGTGG
CGCCCATGGGTCTGGCCGGCATGCCAGGCACGTGGACACGCCTGATGCGCAAGCTGCTGAGTCATCTACTGTTCGTGGTCGTTTATCTTGACGACATCTG
CATCTTCTCGCGATCGATGGCTGACCACGTTGAGCACTTCCGACAAGTCTGCGAAGTCCTGCGCGCTAACAAGCTTTACGCCCGTCCTGACAAGTGCGAC
TTCGGGCAAGCCTCGGTGGACTTCCTTGGCCACACCATCTCTGCTGATGGTTTGCACGTGGACGCTCGCAAGACTCGAGCCATCGCAGAGTGGACCGAGC
CATGCAACATCTAGGACCTCCAACGCTTCTTGGGCCTCGCCGGGTACTATCGTCGCTTCATCCACCAGTTTGCGACGTTGACACTGCCCCTGCGCTCTCT
GGTCAAGAAGGATGTCGCTTGGGTATGGAACGAACACCAGCGCCAAGCTTTCAATGCCATTAAGCTCGCGCTCCAGCACGCTCCGGTGCTTCGTCTGCCG
GACTTTGAAAAAAACATTCATCGTGACAACGGATGCCAGCCATGCGTGCATTGGTGGAGTGCTCTCTCAGATGCATGATGGCAACGATCGCCCCGTGGCT
TTCTTCAGCAAGAAGCTGGGACCTCACGAGCTGAACTGGCCTGTTCACGAGAAGGAGCTCTTTGCGATCAAGCAGGCGCTTACACGTTGGCGTCATTACC
TCCATGGAGTCTCGTTTGAAGTGTACACGGACAATTCGGCGTGCAAGTGGTTTTTGTAGCATCCACGCCTGTCGGGTCGCCTGGCCCGCTTGCTCGACTT
CTTTGCGTCCTTCCAGTCCACTCTGCATCATCGTCCAGGAGCTTTGAATGTCGTTGCGGACGCGTTGTCGCACCCCCCTGATGCTTCATCGAGTCCGGGG
GAGGGACAGGAGGATTGTGAGTCCAAGCCCGAGCCGGTTGTAGTGTGTACGGCGTGTTTGACGTCTACCACATGCACGAACATTCGAGACGTGGTCTCAC
GACGTACCATGGCTACGGCGAAGCTCCAAAGCATACCGTCCCGGGATCAAGCTGTGATGCTGGCCGTCAAACCGCCAGCCACAAAGGCACTCGGAGTTGG
CACAGCACAGTGGTGCATGAGGTTGAACGCAGCGTCAATGGAGGACAGCACGGTGATCAGCTCACTTCAGCGGATAACCAAACGAAGCGGGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCACCAATTCCGTTACCGGCAGCTTGTTGGGATGTTGTCTCGACTGACTTCATCA
CGCATTTGCCAGTGTCCGACGGCTTTGATGCGATCATGGTTGTGGTGGACAAGTTGTCAAAGCGTCCAGTCTACATCCCGACGCACACCACAGCGACCGC
GGAAAACACTGCCAAGCTGTTCTTCAACAATGTCATCCGGTAATATGGAATCCCATCGACTATCATCTCCGACCGCGACCCGAAGTTCACGTCGAAGTTC
TGGAAAGCTCTTGTGCAGCTGATGAAGATCAAGCCAGCGATGACGACTGCCCACCGAGCGCAGGCCGACGGCCAAACTGAGCGTCAGAATCGGACTCTCG
AGGACTCGTTGCGATGCTCTATCTCGTACCATGGCAACGACTGGAATGAGCAACCGCCCATGATTGAGTATGCGCACGCAACACTGGTGTCCACCTCGTC
AAAGCTGTCGCCCTTCTTCGTCGAC