Description :
From Genome Similarity Track
Location :
Scaffold_1481:3041- 4673
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1481-snap-gene-0.3Protein kinase domain containing protein

Sequence
1632 bases(100 bases per row)
CGTCACTCTTGGAGTCGTATGGCTGGTTGTCCATGAGTTCGGGGGACCTACAGATATTGTGCATTAGGCTTTGCAGAAGGCAGATCCGTATAACTCTAGT
ATACAAGGCTTACATGTAGTACGGAGTTCCAACGACCGTCTGAGCTGCATCAAGTGTGTTTTGCAGCGTCCGCGAGACTCCAAAGTCGCTCACTTTGACG
ATTCCGTTCGCGTCCAGCAGGATGTTCTAATCACATTCCACGTGTTAGCTCAGTCTATTGACCTCCTCTATATGAACAAATATTGGATGTGTACACTACC
TTCGGCTTGAGATCTCTAGTGACAATAGAACAGTCCACAAGTCAGTCCTGTTTAGCTCAGGCTCAGTAGGCGGCAGCATCTGACGACAGCAAGACTTTTA
TACCTGTGCAATATCCGATTACCGTGCAAATACTCGAGCGCGAGCGCGATCTGAATGAAGATGCGCATGATCTCGGCTTCGCTCAATATTTCATGCCTGT
GCACCACTGTATTGTCAGCAAATAGACATCTGCAGCCACTTGTCAAAATCAAACGTGCCTGTCCTGGTACGAGCGCAGGTACAAGTCCAGATCGCCCCCA
CTCGCGTACTCCATGATGATCGCTAGCTGCCCGCTCTGTCTCTCGTCCTCAGCAGTCTCGACCCATTGCGTGATGTTAACATGGCGCATGCGCTTGAGCA
GCTCCGCCTCCTGCTTCGCCTGCGCCAGCTGCAGCGCGTTGACTCCTCGCGCATGGTTCGACACTTTCGCAACGAAGAGCTGGCTGTCGCGCTTCCGTCT
GACGAGGTGCACGTCGCCATACTGTCCACTGCCCAGCAACGCCAGCGTCTCGTAGCCAGCGATCGTCAGCGGAGACACCATTCAGTGATTCAATAGTCAT
CAGTCACTCAACAGTCCAAAGTGAAGCCATCAATGTTTGACCAGGGACGCGAAACGGCGCGAGCGTACTGCCAGCCCTTTCTAATCGAATACAAACTTCC
AGTTCAACAGCATATAACACTTGTACACCACTGTAAGCGGCAGATTAATTTTATACGTACTTTCACTTCAATAATAGTACCTCCTAGGGGTCATAATTGA
CAAGCATTAAAGCTGTTTGCATCTCGACAACTCGGAACATGGCGCGAAAGCAGGACCTCATCGACGACGAAGCCGCCACGGATAGTGACGCTGGTCTCAC
CCCGCGGCCGCGGCGCAGACGCATCCGTCAGGGACCCACAGCCAGCAGCAGCGAAAGTGACGGCAGCGGTGGTGAGGATAGCGACGCGAGCCAGATTTCC
CACCAGCAGCGACAACGCCGCGAGCCGACACTCTCGAACTCTTCGTAAACATTGTATCACGGTGTCCCCAAATATGGCAAACTTGACGACAGTTGTATTT
CCAATTCTAGCATGACCGACCTCCCTATATACCGTTGCAACGGTTGAAAATCCATCTGGGTCTTGAATTCTGCTACAGCAAGCACTTTTTTCTACACTAG
TCGACTTTGTTGCTTCTCTTCGCCTTGTCGCCTCCTTGAGATTCTACCAGCGATAACACCATCGGGAGCACCTGAGCGCTCCACTATCTACTGTTTGAGA
GCGTGTCTACTCAGCTCTACTGATTTTCAAGG