Description :
From Genome Similarity Track
Location :
Scaffold_39:304094- 310735
Transcript NameFunction/comments
Phyca_LT1534535625callose synthase putative

Sequence
6641 bases(100 bases per row)
cgtcggcgcgccagctccaactacttcgagttggatgccgatcgacgccgcaacaagtcggagcgctcggagcgcttcagccagcgcctgaacacgatgg
atgtgacgcccgcgagcttcaaaggcgcgtccacggacgacgaagcggccattgattactgctgcgaatttctcaaggctaaattcggattccaggaagg
atcggtaagcaaccagcgcgaacacgtgctacttcttctggcaaacggcaaagctcgttgtttgccaagtgatgcagccgaccaccacctggtgcaactt
gccaacaagcttttcagcaactaccgctcgtggtgcaaatttatccacaccaatcccgtgacgtatactggaagtggcattccgcactctacaccttctg
gcaatttgcacatggacgtcatgttgtatttccttatttggggagaagcagccaatgtccgtcacataccagaatgtgtatgctacctgttccaccagat
gttgacaatggtaaatgccgacccacaaggccacgagcgccaagctgaaggctggtacttagatcaagtgatccgtcccatttggagagaagccagtaac
atgaagcgtcgaaacgcgcttggcaaacctttggaacacgtgaaaatccgaaattacgacgacatcaacgagtacttctggaaacagcactgtctcagca
ttcctgtggctcaagtgggccaggaactgacgcaaaaccacggcaagacgttctacgaacaccgaagtattttcaccttggtgttaaattactaccgaat
tttccagtttaacatcatgttcctggtgctactttcggtcttggcttttgcagtgaccatttcaccagatggtggcaaaagtggctgggtgcaattcgga
cggatcggagatgtggtggagccgtacacgactcgagacttgaaaattgccattgtttccatcccgcttagtctcagtctcatggccttttgcaaatgtg
tcctggaagtttgccacggatggcacttgttgacgtccaaggagagttcggcctcaagttcacgctcattcacgtacggaacggctcttactactcggat
catctggaacggaggctttgctattttgttcggcatcatgatctacgtgcctatgaacgaagacaaggatacgacactgctggacaatttgtacccgctc
tgtggtgcctacatcctacctggtttgctggtgttgctcacacaggcctttgcgcctcaggttatcaacgggacgttcgctgccaagtttgttcgtgaag
gtgaaagctgctatgttgggcaggatatgacgccgccgttctcgttccaggtcaagtacattttgttctggatcttgttgtggatcgtcgaggccatcac
gtcgtacttcattctggttcgtccgctgatgctgccgacgttgagcatttacgctatgacgctggaataccagaactctttggtgtcattccacaacatt
ggcattatcatcgctctttggctgccagtagtgtttattttcaactacgctacgcagatttacttcacgatcttccaggctctgcttggtggattccagg
gtattctcatgaagacgggcgagatccgaggagccaaggaaatgaccaaggctttccgtgtcgctcctcagttgttcgaccagaaggttgtgacgcttct
cgctcgctcaagtgatgccactgccagtggtacggactctacccgtgccagcgctttggcggctgcatacgagtcgcaaatgatgctgcgcttcgtagtg
gtgtggaatgaaattgtgaactcgttccgtgagggcgatttgctggacgacaaggaggcggctatccttcagtacgacatccgtagtaccggagaggtgt
tcgagcccgtgttcctgtcggccggaaagctaacggaagctatgggactggctattaagacggctaaggacgggaagggtgagtcccagcttcgtgtgac
gcttgtggagaacgactgcctttcggccatccgctcgttcttcactgccagcatgtacgttgttagtgctctgttcggaaatgacgacgctgatgtggtc
gacggcttccgtatgctggaggagatcgcttctagtggcggtttccttaagtcgttcaacgtccgtgaactggccagtcttcgagttgctgctgttgatc
ttctggaagagatcttggacctaccggacccggacgtgcagtcgcaacacatcccgaacgctcgtgtgcactcaatgggtgtgattcggaacttcgtctc
caagatggaagctttcctgaatggcgtgcagtcgttctgcgtggaccctgctctacagcgcaaattcgctaactccaagttctgctccagtgctaacgga
tacatgtttgcttcacgcggccttgtcaacctgttctgcagtgacacggccatgggtgctgctacgcgtgcctgtctgctgttgtctctggaccggtcgg
aggcgatgcctcgtacgacagaggcccaacgtcgtcttggcttcttcatgaagtctcttgtcatggacatccctcagttgcgctccatcaaggagatgcg
cagtttctccgttgtgactccgttctacgctgaaacggtgctgttctcactcaaggacctgaacgacccacttgtgaaccatccgatcttccagcaggta
gaagaggatggcaagaacctgactatcctcaagtacttgacgaagatccaccaggaagaatgggacaacttcttggagcgtgtggatgtgagttccgctg
aggaggcccagaagaaccaccctgaggagatccgtctgtgggcatcgtaccgtggccaaactctggctcgtaccgtgcagggcatgatgatgtacgaaga
cgctatcaagatcttgcactggttggaaattggctcaagtcctggcaaatctggcgagcagaagcagaaccagctgcaggacatggtccgtctgaaattc
tcgtacatttgcgcctgtcaagtgtacggcaaacaccgccttgaaggtaaagcccaagctgccgacattgattacttgctgcgcgagtacccgaacctgc
gtgtggcctatgtggacactgtggagcacgaaggtggagagaagtcgttcgatactgtgttgatcaagagcgaatccgacgagattgtggaagtgtaccg
ttactccctccctggcgacccgattctgggtgaaggtaagcccgagaaccagaacaacgccatccctttcacgcgtggcgagttcgtccagacgatcgat
atgaaccagcagcactacttcgaggagtgtctgaagatgccgcagctcctttgcacggccgacctgcacccgtccaagaagcccgtgtccattatcggca
tgcgtgagcacattttcacgggtaatgccagttctttggccaagttcaaaacgtggcaggagctggtgttcgtcacgctgtcccaacgtgtccttgctga
ccctctgtacgtgcgtatgcactacggtcaccctgatgttttcgacaaggtgctggctatcacgcgtggcggtgtgtccaaggcttctaagggtattaac
ctgtctgaggatgttttcgccggtttcaattgcacccttcgtggaggagtggtgacccacgtggagttcatgcagtgtggtaagggtcgtgatgtggctc
tgtcgcagatctcgatgttcgaaggtaaattggccaacggtgctggtgaaacttcgctagcgcgtgaagctcatcgtatgggtcagttcatggacttctt
ccgtctgaactcgatgtactactcgcacacgggcttctactacgcaacgtggatgacgatcgtcacgacgttcgtgtacatgtactgcaaggtctacatc
gctctgtcgggcgtgcagacgcagattgtgtacaacatgaacacgacggagatcattatggacaactcgttggactatgggttcgatgaccgtgtgtact
ccgacatggactcagtgtacaacacacagtactacatccaggctggtctgttcctgtctctgcctctgatctgtgtgtacttcgctgaaatgggtctacg
tcgcggtctcgtgcagttcttggagatggtgtgcactctgggcccggccttcttcattttccagcttggaacgaccatgcacttcttcgacaacaacttg
ctgcacggtgaagcgcagtacaaggctacgggacgtggttttaagatcacacgagagacgttcgtgctgctgtacaaggcgtacgctaacagtcactacc
gcaaggctatggagctggtgggactatgtctggtgtacttgtcgttcggtaagttcgacatttgtgacacttcagtggctggcgagacgaactcgttcgc
gtttgactactgtaagacgtcacagagcttcggtgtgcagacgttcgctatctgggtgatcgctgtggtgtggctcgtggctccgtacatctttaataca
gatggactggattgggagaagactaaggccgatgtgacggcctgggccaagtggatgtacgctgcagaggactacaaggatgaagacacggtgatggttg
gcggatggattggctggtggaagggcgagctcaagctgtaccacaatacgaagcctattgctcgtttcacggtcattctgcgcgaatgccgtcacttcct
gctcatgtggtacgtggtggcactcgagtgggaaatcctgacggtcggtctggtgtttggcgcttccgtggtcactgttctggccatgggtctcttcgga
gctatcggttctactatgcgcaacatgaaggcgtcgacccgcgcgatcctgtacacgtttgtcttggtggtggcgctcatcgcgttcttcgtggtcacac
tcgtcatctctgacttgagcttcacccgtacgatctctctgttcttcggctacatggctgctctgtacggaatcaacgagatggctcgcatgtacagctt
cgcgaactcggggatcgctactgttggcatgttccagcagttggcgttcttctttgacttcgtgtttgcagtggctatgatcgctcctcttctcgtcatg
tcggcgatcccgttcctgaatatcatccagacgcgtatgatgtacaacaagggtttctcggaggttgtctcggcttcgtcgcagtacgccttctcgctgg
ccgccttcatgggtgtgcttggtggcatgggctgcggctggttattccacttattcagcactcttgagagcacggctggcttcctgagttacgttacgac
gtacgacctgctggacggcaacgtcggggacggctctgtgacgtacgcgttctacttcgccagtatggtgggcacgttcgtggctggtttcctgaactac
ttcatcggccgtcgactgtcgatcgtcttcggcgggttattgactgttcttggtatgttgggcgtgagcgcggtgcagactggtggtgaaggcttcctga
tgcctggtatctgcttgcttggtggctctgtgggtgtacttctgcctactttggctgtgtacatctacgagatttcgacccgtgacatgcgtggcaaggc
gttattgcttctaggcagtggcttcatccttggcatcttgttcgctgcctggttctcctcgtcgtcgaacgaggttggctgggtgtggcaggtgttcatt
gcgaccattattctgtcgatcatgactccggcggtttacattttcccggagagtccgtattgggtgtacatgcgcgaaggtctggagtcgtgcgagcgtt
gtctggctgtactacggcgtaaggagggtgtgtcagaagaactgcgtatgattcgcgacgaagaggccggaagcgacgactcgagcgccaacggtggcac
gtcgttcctcaagttcatgatgggtttgttcctgatgctggtctccagtatcttcctgggctgcgtcaacatgtacctgtcggacacgttccgcagcatc
gaggacgcgacgtacatgttcgtgaactgtatgggcttgcagttcctgggtgcactcttctcgttcttcttcatggaccgcatcgaccacaagcgcatcc
tgttctgcacgttgctgcccatggctggtctcgtgttcgttcttggcctgaacgagaagtcagagttcgtgacgggcgatagcaggtacttgttgctgca
gatcgtgggtctgctgctctacttcttcgctggtctgggaatcacctctgtgccttgggtgtcgtgcgtcggcttgttcaacacgaggcagcgcgcagtg
tacgtgaccgtctacttcatagtcttcttcctgttgcccgtgtgcgccacatacatccgctcgagcgagtcgatgagtgatgaccagtacatctacctgt
tcgcgttgactggctgctgtgtagtggcgacggtgcttctgttcaccgtaggaaccctcaagaacggcatggtgtgcaccaagggcgagatggaggccga
acgtgcgcgtctgcgtcgtattcgggcatcccgtcgcagcgcccgcacgcccggcagcgcccgctcaaggaacttcagccgttcgcgagcaaagtcgcac
tcgaactatcagatgttcgaatcgcccgctggcagcgcgcc