Description :
From Genome Similarity Track
Location :
Scaffold_57:304071- 306829
Transcript NameFunction/comments
Physo_137800pectate lyase, putative

Sequence
2758 bases(100 bases per row)
AGCAATCCCCACCTTCTGGCAATAAGTCAAAAGCTTGAACATTCACGTTTAGATCCCTTTAGCTACGATTCGGGTAAGAGGAAGTTTGTTTTCCAACGAC
GACCATTGGTGCTTGAGCTAGCTGCTGCTGTTGTTGTTGTTCTCAGTGTTTTGCTCGCTCTCGACAACGTGAACATCATCATAAGAGTACTGGCACACCG
GATACTTCTCAGGATCACCGGTTTCACGCCTTTCGTATTCAGGCCTAAGGAGGAGGCATACTCCGTGTAGTTGTACGTGCTCGGCTTGACGTAAAAGTTT
CTGAATACAGCTTGGTCGCCGAAGTTTCCGTTCATCATGACAATGCTCACGTTTGGCTCATCCCGCGTTTGGTCTTGATGATCTCCAGGTCAACGTAAGT
GTTGCTGACGTTGAGGAAACGCGGACGGGGGTTGCACACGCAGTTGCCACACGAGCGATACAACTTGCCGAAGTCCTGCACGAAAAAGCAGTCAACGACC
ACAGTGCCAAAGCCATTGTGTTGGATCACCTTGTCGTCCGCGTAACGCGCTCCACCGCCGAGAACTCGGGAGACGCTGGAGGCGTCGCCGCCATTGATGC
TCAAGGCATCCTCGCACACGTCCTCCCACCACACGTTCTCGATCGTGCAGTCCGACATCTCGCAGTGAACTCCCTCCATTTGGTTCGTTCCAATGATGGA
TGACGTTCTTCAGCGTGGCGCCGGGTTGAACCTCGAACACGGCCTTGGACGTTCCATTGCTCTCAGTTTGGCCCAGGCACGTGATGTCCGAGCGGTCGTA
GGTCTTCATGCCGCCGTCAAACACCTCTCCAGACTTGACGACGTAGACTTCGGAGAAGCTGACATTGCCTGACTGGCAGGCCACGTTCCATCGGGCACGG
GAAGACCGGTCACGATTGATGCGGCAAGCACGAAGGTTGCAGCGGATCCGAGAAACTGGAGCATGGTGGACGAAGATATCCGGGAACTTGGTTGAGAAAG
TTGCTGCTCGATGCGTCCAAGAAGTGGGAAAAGGAGAAATGAGGAATGAAGGAGACGTCGAGGTTGCCCCGCCACGACGCAAGCGACCTGATGGTCGGGT
GCAATCAACGCTGCCTTGACGCTTTTGAGCGCTACTCACATCAAGGACACGCGCGAATACAAAACTCGATTAATGTTGTTCAATGTTTTTCGCCACCTGG
TGGTGGTTTTGTGGGCTTGCGTACTGCGGACAGATCGACACGCTCAATCACGGATGTGTCGGGGGCAGGCCTTCCGAAAATACAGTCGCCGCAGCTTTTG
AAGCTGCATCACTAATAAGTTATTCCGCGGACATACCGAGGTCAGAGAAATAAATTATTCAGTATATTGCAACAATTCCAACACAAGATGACAACCTGTA
TTACGTAGTTAAGGTTATACTAACCTAAGCGTTCACAACCTTCGACACCGTAGCGGCTCCCTGCAGACTTGGCGGGTGCTGAACGGGTTGTTGGTTGCCA
TCTTGATTCGAAAATGAGGACGACACTAGGAAAGAGACAAACTTGGGGATGCTAGCATGTTAACTATGGTAAGGGTGTTCTAACCAGTGCTTTGTGGCGT
CTAGAAATGCAGCGGAGACCCAGAAACGCAAAAAAAAGTAATTACCTAGGAAAAACGTACTTTTTTGAAAAATGCTTTTAACGACTGAAAAATACTTTGT
AAAAAGTCAAGCCGTAAGTTATTCCACTTTTTCCACGGTCGCGTAAAATAACTTATTCCGTACTAATATTTCCGTATATTTGCCGTACAATCTTATATTC
GGAAGGCCTGGTCGGGGGCAACAGACAAGCGCAGCCTGCAGCGGATGGACGCTTCTCGTACACTGGATTGATTCACCTGTCGAGCCCCACCGCGTTGACG
CGAACGGAGTTGCCGCCGTAAACTCGAACACAACCGCTAAAGCAGCATGTCACAAGGCCCTTGAGGAAATGTTCGTACGCTGAATCATGGATACATGTAA
GCGTGTACTGGGGTGGTTCACATCGTCACACCCCAATGCTTTGATGCGTAGTTTCGCTGAGCGGTCCTCATGGGTCACCTTTCTTCAGGAAATACTCGTA
AACTCAGCTTGGCTCAAACCTCTACAGAAAATACTCGCAAACTACAACAGGTTGCTCCAGTTCATCCCATTATGGTTGTTGCTCTCGATAGACGAGTGCT
CCGATACGTACCGGTAATTGGACTTTCGACTAAGCAAACGTAACGCGAAATGAATATCTGGGAACTGAAATCAGATAAATGTACATGTGCAGCCTACCAT
GTAAACTTGCACTTAGCGTCTGTGCTTACAATACCCAGTACATGTACAAAACGTGTTAGTTTAGCACTGTGCAGGGCAGTGTCGTTGTCCCAGTGCTAAT
GCTACCGGTAAGCTTATAAGACCCAGTACATGTATACTGATACCCCACCACGGTGGTAAGAGTGGTAAAAGTGACGGCTCGCGTAAGGCGTCACAATAAC
TTACAACTAGCGGAGCATCACGTTCGCTGTGCTCATGTTGCTTCAGGGGCCGACATCCAAAACTATGTTGGTCACAGAGTTTTGGACGACGTCCCCACTC
GAGAAATTTGTTGCTTCTCCATCCGCTTGGCTATTTTGCAAACAACATACCATTAGATCTTGTTGACGGTAGACCAGCACACTGTAGTAGGTTTCGGGAC
TACGAGGGAAGCTGGTGTTCCCGGGCAAACCAAAGCTCTGTTTTTGGTTTAGAGGTAA