Description :
From Genome Similarity Track
Location :
Scaffold_1876:304- 2499
Sequence
2195 bases(100 bases per row)
GTCAGGTAGTCCGCGGCCGAATTGTATTCACGTTTCACGTGAACGAGCCGAAGCGTACTGAATCGTCTTTCCAGAGTTTTGCACCGAGCCAGATGTCGTT
GAAGGTTGGGTTGGTTGCAGTTAATCAGCCCTTGGACTTGTTGTATCACAATGCGCGAGTCTCCAACCACGATCAGGTCTTGAACGCCCCGATCCAGTGC
CATGGTCAGTCCATTCAGTAAGCCGTGATATTCTGCATCGTTCACAGTGACATCACTCAGGATGAAACCTTGTGCATCCAGTACGCTCCAACCAGGCAGG
CTCCACAGGATGCATCCGCAGCTTCCTCGGCGAGTCGACGTCTTGGCTGCTCCATCGAAGCTTGACACAATCCCCTCAAAGTCAGCGTCCAACATCTCCA
TGCTCACCACCGGTGGTGGCTTGACCCGCCGCTTGGCTGGAATCAGCGACTCTGCGATCCGGTCCAAGTGCTCTCGGGGGGTGATACCCGCACCGAGTAT
AGCGGCTAGACCGTCTTCATCTCGCTGAATTCGGCGAACTTCCAGGTCCCACTCGGAAAGAGTGACGCCCCATGGTACGCAACGTCCATCCGCCGACTTG
GACTGAATCACCCACTTGAGTACCGAATAGCGGGTGTACACGATTATCGAACATCCTTCCAGGATCGTCCTGAATACATTCAGTACTCTCATGATCGCGA
TGACTTCCTTCTCCGCAACGTGATATCGGACTTCCGAGTCATTCAGTACACGCTCCGTGAAACGGACGGGCTGAATCAGCCCGTCATGCTCTTCACCGAG
GACTGCACAGGCTGCCCACTGGCTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGGATGACGTAGCAATGGGGTCGACACGATCTTCCGCTTC
AGGATCTCGAACGCTTCCTTCGCCCTCGCCAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACAGGACTGCAGCTACCATCGGGAAATCCT
CTATGAACTTATAGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATGGTAGATCCAGTACGCCCTCAGCGATCTTCGG
CGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACTGACAGAGATGTTCCAGTAC
CGCAACCGAAACAGTAGCGCATCCAGATCGATGAAAAGTTGATCCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGTACGAGCTCCGTCCTAGGACAG
GGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCCGGTCTGTCAGCGCGGGTAGACGTCGGCCAGACAGGATTTCGTCGTCCGATCC
GGTGTCGCTCCCTGCGACGTTGTCCTCTTGCAGCTTCAAACCCAGATAATCCAGTACGTCCTGATCCACCTGAGCTTCCTTACCAGGTGGTAGTCGAACA
AAGCCCCACAGACAGTTGTTGAGTATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATGCGTCGCCACTGGTAGTGACCGAATGGCGACA
CGAACGCCGAGATGAGCTTGGCTCGCTCCGTCATCCTGATCGCCCAAAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCGCGCTCTCGAACCCGAT
TAGCAGGTCGTCAATGAGCGAGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATGCACATCCGGATGTCGACCCCGTTCTTC
TTCAGTACGATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTTTCCAACAACTTCTTCAGCAACGCGTACACCTTCATCGCAA
GGTGTGGCGCGACCGAGCGTGCCCTCTGTGCGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACTCCGCGAGCTGGGGCTGGTGCCGCATTTCC
ATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGCCAGGTTCGCCAACATCAGCCTTGTCA
ATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGCTCCTTTCATGAATGTACAC