Description :
From Genome Similarity Track
Location :
Scaffold_1729:304- 2072
Sequence
1768 bases(100 bases per row)
TTGCACAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTGCTGGACTAGCACCGAACATGAGG
CTCTTAAGGCCGTAAAGGAGAGTGTCCTACATGCCCCAATTTTGGCTTTGCCAGATTGTGATCGGCCTTTCAGTGTCGCCTGTGACGCTTCGACCTTGTC
ATAAGCTGTGCTCTGTTACAAACAGATGTTGAGGGACGCGAGCGTGTCATCGCATTTGAATCCCGTCAGCTCAAAGCTGCTGAAAATAACTATCCATTTC
ACGACAAGGAGCTATCTGCTATGAAGTATGCTATAGTCAAATTCATAGTTCATCTGCTTGGCTCTAAGCCTTTTGTTGTCTATACAGATCATGCATCATT
GCACACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCTTTGGCTCTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCGGGAAAG
CAAAATAATTTGGCTGATGCGTTCTCACGCCGGCCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATACTTGCATCTT
ATGCCAAGGATGAACAATGTGTCGCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAGAATCGGACATTAAATTGTCGGCACATTCGTGTGCGAGGCT
ACATCGATATTCTATCTACAGCGGCTTGTTGTGCTATCGCCCGAATACTGCGGATACCTCGCGTATTGTTGTTCCTCATCATGAAGAACTGAAGTAGTGT
ATCCTCTATGAGGTCCACGAGACAGCTATTAGCGGTCATCTCGGTCGTGAGAATACCTACGGCTTGGTTAGCCAGAGTTATTGGTGGCCGAAACTCTATA
AATGGGTTAGCACTTACGTGCGCACATTTGAGACGTGCTAACGGGTCAAACCCTCGGCACATGGGACTGTGCCGCTTGATAGTTTGTCTGTAGCCTCTGG
GTGTTGTGAGTCCATTAGCATGGACTTCGTGTTTGGCCTACCGAAGGATTCGGTGGCAACACAGGTATTGTAGTTTTTGTAGACCGTTTGAGCAAGATGG
CTCTTTTAGCAGCTGTGCCGGATTCGATTGATGATGAAGATACAGATTTGCTGTTCATTGATCGCATGTTTCGCCAACACGGACTGCCACTGGCAATTAT
CTCTGACCGCGATCCTCGTTTACGGGCAAGTTTTGGAAGGCCATCTTCAAGGTGCTCGGTACCAGATTAGACATGTCTGCCGCGGATCATCCCCAGAACG
ATGGTCAGACTGAGCGTGTCAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGAAGCTCCATGCTCCCCGTTTTTGA
GTTCGCTATGAACAATGCCGTCCATGCCTCGACAGGCTACTCCGTTATACGTGAACGGCCTCACACATCCCCGCGTTCCGTTAACGCTACCACTACGTGG
CTCAGGACTCGGTGGGGGAGAGGTGGTCGATCGGTCTGCTGATGTCAGCCCTGCTACTGTTCAAAAACAGGTTAGCGCGTTCCTAACAACGCGATTTAAT
GTCTTACGACATGTGCGTGACGCAATGAGTGGTAGCCAAGACAAACAGAAGGAACTAGCGGATGCTAAAGGCATAATCTGTATTGAAAGTTATGAGGTCG
ATGACCAAGTCGTACTAAACGCTAATAACCTACCTACCAATGTAGTGTCTGCTGTGTTTAATACTAAG