Description :
From Genome Similarity Track
Location :
Scaffold_1360:304- 1419
Transcript NameFunction/comments
Phyra_86889reverse transcriptase

Sequence
1115 bases(100 bases per row)
GGCAATCACGATTCGGTGCTCGCTGGAAGTTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTT
CTTCATGCACCGACCTCGGCCGGGTGAGGAGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTTCAAGAGGCG
GACTTGGCTGAGCCCTGGCGAGTCCAATACCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTT
CCCCTTAAGCGTACACTTGAGTGTTAGTCTGCATGTAATTCCATTTTCACCTCCTTTTCTCCAGTTGTCTTCCTTGATCGGGTTGATCGAACCTCGTAAT
CGGTTCTCTCCCCTTTCACGCCACTTGTTTTTGTACGTATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCG
ATCGCCACGAGTTGCCCTCCTTCTTCCTAAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCG
TGCGCTTGCATCACTCCGAAGCGATTCCGTCTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACG
GTTCGGTGTATCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAA
CTCGTCATCACTCCGATCACCTTCCCAGCTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCGTCCGTTGCTAGCGTCACGTCAGGA
CGATCAGAGAAAACCTTCACGGCCTTAAGCTTCGAAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGC
CAATCATCTCGCGCACCCGGAACGGTCCGTGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCC
GGCCTCAATCTGGTG