Description :
From Genome Similarity Track
Location :
Scaffold_41:303971- 305541
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14775malate synthase
Phypa_INRA-310PPTG_14776protein kinase

Sequence
1570 bases(100 bases per row)
TCCTGGCATGCCAAGGACGAGCTGACTGGGTGATGTGATCCGAGCGGTAGGAATGTTGGGCGGTGGGACTGCTTGGTGATGACAAATGGAATGCGAGATC
AATGAGTGTATCGACGCCAGCAGTGTGTTGACGTTCGGAGGACGAATGTTGGACGATATTTTATAAATGAATGTACCACGGAATGAAAAACATCACTTTC
TTATGGCAACATTGAACATGTACCTGTCAATTGTAAGATCTTTGAGATTGTTGTGATCTTTGCGTTTTTTTTTTTTTCTAAGACAGTGAGAAAACGTTTA
CACAAGGCGTAAACTTTTCACCAAGTCAATGATTGTGTTCAAAGCTTAAACATATTGTTGTTTGTGGTTAACACCAGTATCAAAAGACTACGTCAGCTTT
GACAATATTTTGGTGAACTAAATCATACCCGACGTGAGTCCATAATTTCTTTTAACTGTCGGTGTCTTCGGTCTTGATGGTATTGAGCGCTGCACTGCTG
TTGCCTCTGAGAAGCTTTTGGAGAGATCGATAGCCAATCCTAACGGTACGACATTCTTGGCCTCTTCGATGAGGAAGATGACCGTACTGAAGGACGGCCG
CTGGACCGGGTCAGGATCCCAGCACGCCTTCATGATTCGATGCAAAATTTCTGGGATATGAGGCAACAGTTCGGGGCGGAGATCCTCGTGAGCAACGAGG
TAAGCCAGATTAATGGCATCCTTGTCCAGATACGGCTTCTTGAAGCAGAAGAGTTCCCTGGTTTCAGTAAATCCATTAAATCCTGCATAATGTTGTGTAA
ATGCAGAGATCGCGTACCACAGCACGATACCGTATGAATAAACATCGATCTTCTCCGAGTAGTCCTCGCCTCGAAACACCTCCGGTGCTAACCACCGCGG
CGTGCCGCACATCGTCTGTGCGTTGGCGTTCTTGTCGAGGCTGCGTGAGAGACCGAAATCGCTCAATTTGCAACGAAAGTCTTCCGTGATCAATAGATTT
TCTCCCTACGAAAGCAAAACTATCGTCAATGAACCGTTCTATGATCGAATATCTCAGAAAATATTTTTGCAGTTTATACCTTGATATCACGGTGAAGCAC
AGCTGGATTAAGCGCGTGGAGGTAGGCACAGGCTTTTGCACAGTCTAGTGCGATTTCGAGTGTGAGCCCCCACGTGATATTTAGCTGCTTGCTGCGTGCA
AGTTGAAGCAGATCTGCCAATGATCCAGCACAGAGCTCTGTGAGAAGACACAACGTTGGTGGCTCAAGCACGGCACCGAGAAACATCACGATGTTAGGGT
GTTGCAAGATGGAGAGAATTGACAGCTCGTTCTTGAAGTCTTGCACAGTCTTAGCAGAATACCGCTGAGCTAGTAGTCGCTTGAGCGCTACGTGTTTCCC
TTTGTAGAACGCCTTATATACTACACCAAATGTGCCAGTGCCAATTTGACTCTCAATCTCAATTTCTTCGAAAGGAACTTTGAGTCCAAAGAAGGTAGAG
CTATCAAGGCGTCTTGAATCTGTGATTGGATTCACGCGGTGCTTTTTCTTGGACAATGCCACGTAAACGA