Description :
From Genome Similarity Track
Location :
Scaffold_103:30397- 32095
Transcript NameFunction/comments
g13078.t1hypothetical protein

Sequence
1698 bases(100 bases per row)
AAGCTGCCGCTCGAGCTGGAGCCGCCACGGGATGCAGCGTTGTACAAGGCCCATGAACGGGTGAGACCGTCGTCCATGGTCGCTGTCGTGAGCCTTGACA
GCGCATCTGCCTGATTAATCGCCGCTTCGTTAACAAGGAGAAGTGACAACCACGCATTGCTAGTGTTGTCACCCGTGACAATCGCCTCCTTCGACAGGAT
GTCATCCCATTCCTCCTGAATGAATGCAGTCGTGCGCACCAGACCATTGATCGGTGACACAGGGATCATCTGGATGCCGTGGATACAGTGCTTCTCGGCA
CTGAACCACGTCGCGTAGTCCGCCTTATTGTCGAAGAAGATGCCCGTGACGTGGTTGGGCACGAACTGAGGCGGGTGAATCGTGTTGTCCGACGTCATGA
GGAAGTAGGTGCGCACTGTACGCGCGTTGAGGCGCAGCATGAGGCTCCCCAGGTCCTCCACCGCCTTGTTCCCCGCCGCCTTGCCCCACAGCATCATACC
GTAGTAGAAGTTCACATCCTCCGACGTGCTCTCTTCATCCTTACCATCAGCCATGGGGGTCACGCCGTGCGAGTAGGAGTGACCCAGAAACCAGGAGAAG
TGGCGGAACTTGGGGAAGTGTGTGTCCTCCGAGCTCGGGTTGGCCACATCGCGGAGCAGCGTCCACACCATCGTCTCGAGTTGAGCCATGCCTGACCATG
TCGGATCCAGCTTTTTCAGGATGGCCGACGCTGTGATCCAGTAGCCGTAGTGGTAGTGATGGTCGTTGTACACTCCGTTACCAAACTCTACGTTGACATC
ATTGTTAGTGAAAACCTGGCTTGTCACAATGCCCTTGTACGTTGTCTCGTACACCAATGGGACGCTCAGCGTGTTGCTGACAAAAGGTTCGATGAGTGTC
TCCAGCTTCGACAAACAACTACTCAGGAGTGTAGTGTCATCTCCCACCACTGAGCTGTCGGCGGCCATCAAACACAATGACGCGTACTTCTGGTACGCCT
TGCCGTTGTAGTACCAGCTGCCAGTGTCCAAGCTCCAGTCACTGTCAATGTCGCTCTGCAGCGTGGCGAGAAGACCAATCTGCGAGACCACGTCGGCAGA
CGGCTTGTTGGCTGGGTAGAAGTCCACCTCGTCGTCCGCTTCGTCCTCCGTCAGCGTCCAGCTACCAGACGTGGTTACCTGACCCACCATGTCACCGCGT
GTACTCGAGTGCAAGACAATTGCTCCACTCGACTGCGCCGCCGTGGCACTGCTCATGACCTCCACTTGGTGCGGCAGTGCAAAATGCAGAAGACCTGTGC
TGTCGCACCCACTGCCTTCCGTCTCCCACTCCAGCGAGTAACTCGTGCGAGACTGCACCGACACGTCGCCACCGCACACAATACACGACGCGTAGTCGTC
GTACACGTCCTGATCGCTGTTTTCGGGAAGAATTGCCACCCGTAGCGTGCCGGTGTAGGCGGCCGCAGCCACCAGCGCCGACCCCGTGCTGTCGATTGAG
AACGACGCGCTGGTATCGCTGGCAAAGACCACCCACGTCTGGCCGTTCGCGAGCTGCACGACGAACTTGCCTGGCGTCGAGCTATCCAGCAGTGTCATGG
CGTAGTCGGACTGGATGCTTGCGGTGAGACCAGCGTACGTGGCCGACACGAACGCCATGCCGTGCACCAGCGCCGAGTCCATGCAGGTCGTGCTGCTG