Description :
From Genome Similarity Track
Location :
Scaffold_170:30390- 35854
Sequence
5464 bases(100 bases per row)
TCGCCCGAGGAAGAGACCTCGTGATGACGGTAAGGACGGAGACGGCCGACATAAAACGTAGGGTGCGTACGCATCCTGCGAGGCAACTCGATTGTGTACG
CATTGCCTTTGTGATGTAGTACACGGAACGTGTCGATGTACTTCGGTAGTAGTTTACTACATACCCACATTAGTTACTACGTGCTTAGGTATATTTACCG
TAGACATTAGAACTAAGTCTCCGACATTAAATAGAAGAAAGTTTGCTCTTCCATGTTTGTCAGCATTCCGTTTCTGCCGGTCCACCACGTTAGCGATGGA
GTCTTGCACGAAACGGACCACTGCTTCTCGTGTTAACAGGAAATCTTCTGCTGAAACACTTTGGTTTGTTGCAGTGCGTATTGTGCGCACCACTAGGAAG
TCATCCTATTTTTCAGCGAGGGTGTTCTCATCCTCGCTGATGTATTCATTGGCGATGCTAAATATACCAGCATCGTCATCCTCATCTGGTTCAGCAATAG
TGTTTTCACTATTGCTGAGATCATCAGCTTCGATGTCGATTACCTCAACACGTAATGAGCAAGAGCCAGAACGGTTTTTGCTCGAGTGAATCCCTCCCCC
CTTGAATTAGTGTCACACTCTAAACGGGTGGGTAGGCGTGGATGGCGTGGATGGCGTAAGCCGTTCACGAAAAATGGTGTATGCGTTGTCGATGCATGCA
CGGAGTTGTTGATTGCAAACTCCACCATCGGCACATATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCGAGGGATCTCTTCGAGGACGCGGTTGAC
GCGTTCTGTCTGACCATCAGTCTCGAGGTGGTCAGAATTAGACATAGTCAGACGTGTTCCGAGGGATTGGAACACGGATTGCCAAAACGCCGCCGTGAAC
CGAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCGTGGAGTCGAAATACCGTGACAATGAACACACGGGCACAACCATGTGCAGAGATTGACTCAT
GAACTGCAGCAAGATGTACCATCTTGCTGAAACGGTCTACGAACACAAGAATACCATTATTTTTGTGAGCGTCTCCGAGGAAACCAAAGACGAAGTTTAT
TGAAACGGACTGCCAGCACTCTGCCAGAATTGTTACAGGCTGTAGTGGCGCACGGGATGAAGGACTGGGATTCACCCGTTGGCATACTTCACAAGCACGG
ATGTACTTACGCACGAACTGATACTGACGGGGCCAGTAAAAGTCGCGGCTTACCGTGATATAAGTCTTCTCACGCCGACGATGACCACTAGGTTGTGCAT
CATGTCACTCATACAAAATTCGCAAGCACAAATCATTATGAGTGGGGACGACGACACGAGGTGTGTCGCCGGCAACGGCTGTATAATACAGCAATCCGTT
GCGTGCTGTGTATCGATCCGCGGAATATCGATACAAGGCCGGTAAATCTTTGACAGATTTACGAGAAGGAGTCACAAGATGATCCATTAGTCGCAGAAGA
TCCTTATCTTCTGCGTAGGCCTTTTTTATGTCGTCAAGCAATATTGACGACGGGACACTAGTGACTAGTGTTGCACCAGTGGTATCAACCTCACTGTTGG
ACTGCGCAGCCAACACGTAATCGGGTCGGTGAGACAACGTTTCCGCGACGACATTAAGTCGTCCGGGTTTGTACTCCACGGAGAAGTTGTACCCCGCAAA
GAAGGATATCCACCTCGTCATCCTTTGCGAGATGTGTGGGCTGTTTACGGCCGTGTATAATGAAGAATGGTCCGTTATAGACTACGAACGGCCTATCTCC
ACGGAGATAGACGCGAAACTTCGCTAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGCACTGGATAATTACGCTTAGCTTCTTGGACCTGACGCGAT
TGATTACAGACGACGCGATTTGCGCCGTCTGCATCGTACTGCATTAACTCTCAGCCGATTGCGAAATTGCTGGCGTCACAGATCACATGAAATGGTCTGT
CTTGGTCTGCAATCGCCGAGATGGGCGATTGCATCAAGCTCTGCTTGATAACTTCAAAGAAACGCTGACAATCAGCGTTCCATGACCATTTATCGTTTTG
TTTTAAGAGACGAGAGAGATGAACAGTCATCTCGGCGTAGTTGCGCGAGTACTTATGTAAGTACGTTGCTAGATTATGGAACTTTCTAAAACTCTTAATG
TCGACTGGCACAGGACAGTCGGTAATCGCCTTGATGTTTTCTGGATCAGGGCGTACGCTGTGTTTACCCACGATGCACCCAAGAAGTGGTATTTTGCTAG
CAGCGAATATACACTTCTTGAGGTTGGCATACAGCTTATGCTTGCGCATAAGTGTAAGAACCTGACGAACGTGTGTTCTATGAACCTCTACATCCGTCTT
TTCGCCCATAGCCCGGCTATGGACGAATACATCGTCGAAGTAACTCGGTGCGAAGTCTCACACCTGTCTCAACAGATTTGTAACACATCTGTTGAATGTG
GCAGGGGCGTTATTAAGCCCTTGTGGCATTACTAGCCACTCCCAGAGTATACCGCTCGGGGTGCTTACTGCCATGTACGGGATGTCCCGTTCACGCATTA
GGATCTGATAGAAGCCATCCATCAGGTCCATGGACAAAAAGATGGTACTCTTTGACATACCATCAATGATTACATCCCTCCTCGGTATTAACGTATGAGC
CGGTACCGTTGCAGCATTTAACTTGTTGAATGCGTGCACAACATGCCATCCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTT
GACTCCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCGCAAGTACTCGTTCACAAGGCAGCAGCCACTGCTTCATAACACAGCAGT
TCGAGCTCGGTTTGAGCTCGATTTCATGTCGAGTGCCTTTATCCTTAGGCAATTTGCATGGTACGGATTCAGAGAACACGTCCTTGAATTCGACCAAATC
CTTATATAAATGATTTTCCTGAATCTACTCCCACGATTGAGACGTGTATCGCTAATCCGAGTCTTCTCATCGAGGACACTTTCTTCTATCGATGAGTTGC
TGAGAACCCATTCGTTCTCGGAAAATATTACTGCCGACCGAATGTCAGTCACGTACTCGTCCTCCGTGACGAGTACACAGATCTGCTTGACCTTGCCACT
ACGCAGATATCGAGAACCGTTTCTGTTCTAGTATTGGCAATTGAGTGATCTCCGAAGTCAACTTCGGAGGCGCGATCAGATCAAGTTTATAAGCGCCTAC
ACTTGATCCGTCATTAACCAAGACATTCAATGTCTCGATTTCTTCCTGGGAACCCTTTTCTACAGGCTGCTGGGGACTTATTTCCTCAGGCTGATGAGGT
CTCATTAACTCACCAATAACTGCTTGAGGAATTCCTTCCTCAAGAATGTGAGGAATTATTACCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTA
GGTCCTCCACGATCGACTCTCCAGCCTATCTAGGATCATCGTGTTGCCCTATGTGGGCAACTAGTTTATTCGCCCGCTAGGCGTACACCCATGTCCCGAT
CCACTCGACTTGTTCGAGTGGTGGAACTTCGGCGCTGCCTGTGCATCCGCACAGCCGCCGGCAGCTTCCTTCACAGTGTGACAGCCAATCACAATGTGAT
CTTGTGCAGTCGTACTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTACATGCACACGTCTGTAGACGCTCCAAGATGTTCATCAGATG
GCCACCTGATGAACAAGTAGCAGGCATCTTCACGGTTCGGTGCTGCCAGCTGACCCTTGGCTCGTACCTTCTGAGCCAGGGTAACCCTAGGATGACATCA
AATTTGTCATCCAGATCAAGTACGATGAAATCATCATTGTACTGCAAATATTTTAACGTGTAGTGAAATCCCACTACACGTTTCATCACTGCTATCGATG
CGCCTGTTGCGAGGCGCACCGTCGGCCTCGTAGGGAGAGTAACGCGCTCAACGAACTTGAGCCTACGATCCTCTAGCGACTGGCGACGAACAAAGCTGTT
CGACGCCCCCAGTCAATTAAGGCACAGAGTGACAAATCTTTTGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTGCAGAGAAACACA
AGAATTTTGAGTCTGGAGCAACTTTTATCAATAGGTTTGCAAATTCTATTGAGGTAGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCTGACCGGTT
TTTGACGGTCCGCCACGCTGTTGTGACTTCGCAACAGGGTCGGACCCGCGTACGTTGCCCCTCTTGGCAAACGGTCGATCACTTCACTCAGTGTTACGAG
ACACTGGGCGTGAAGCACTACATTCGTAGGCTTAGTCTCCTAACTTCTGACAGCGATTGCATTTTGCAATCGCTTACTGCTTGAAGAGCAAGTTTTCTCG
CTCTCGACACTGCAGAGATCCATTGGTTCTGAACCTCCCTCCTCTACTCGCCTCGAAGGACGATAGGGGGTCAAGCTAGTGTGAGCCTGTCTCACACTAA
ATTCCTCTTGCACCACAGTTGTAATCGCTTCCTCAAGCAACTTCAACTCGATGCGGAATAGGTGGTTCCTCAAGGGACCATCTATAAGGCCCTGTAAGAA
TGTCATGATCAACACGAATTCACTTACAGGATTCGCTACCATGCAACTTGAAAGGTAACGAACGTGCTGAGCGTAAGCGTGAACGTCACGCTTGCCTTGT
TTATCTTCAGGAGCTCTGTTAGAGTCCTGAACTCAGCTCTTGGCGGCTCAAACGTTTGGCTGAGCAGAGTCTTAAAGACCGCCAACGATCCAAACACGTT
TGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTTGCACGCCGTGACAAATTCGATTTGGCAAATGCAACTTGCATTTCCTCATCGTCGATGTGGCGA
GCCTTAATGGCGTCGTCCAATTCGAGGAACCATCTCAACAGGGAGTCTACCTTGACTCCCCGGTACTTGGAGACTTTTAACTTTAGAGTCTCGCGTCGAC
GCTCACGTGTCGACGCTGCAGTAGCAGACTGAGACTGTTGCTGTCTCATGAGCTCAGTCTGCTGATGACCGTGCTGATGCAGCAGGGTCACTTCATCTCG
CGACGCGTCAAGTTCTCGCTGCAAGAACTTGGCGATTATGGAATGCTGTTGGTCTCTATCCCTTGAGGATAGCAGAGACCAGACAGCTTCTTAGCCAACG
GTCGAACTCATTCGTTCGACCGCACTCCATTCGACATCACTCAAATAGGATTAGTTTTCACGGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCGTCCAACA
TGTTCATGTTGAACGGATTTTGTGGTCCTTGGATGGACTACAAAGTGCTACCAGGTGTAACGGG