Description :
From Genome Similarity Track
Location :
contig_47:303879- 309435
Transcript NameFunction/comments
g9242.t1hypothetical protein
g9243.t1hypothetical protein

Sequence
5556 bases(100 bases per row)
TGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGATCCGCGCCGAGAACGAGCGCCTGTCGCGCGAGATCCACGCGCT
GCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGACGCGATTGAGGCCTCTGGCAGCGAGAAGGTGCAAACGCTGGCG
CACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCATGACGGAGATCCTCAAGAACGCAGACGCCCAGAACGAGGTGG
ACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGACGCTGCAGCGTGCCAGGGGCATGTCGATGCCGCGCCAGCGGCG
CTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATCCCACCCTCAGGAAAGCACAGCCCCGACGGGCCTCGTCCGCCC
AGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGAAAAAGAGTCTGTTGTTCTCCACTCACTCGCACTACGGCAACT
TCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGTTGCCTGTCCATCGCGTCGAGCCCACCCCGGCAAGAGAGAGAG
AGCACTACCTTATTTAACACCAACCCAGCATGTTCAGCCATTGGAGCAGCTAGCTATCCGTCCAGTCGAGCGTCGGGCGTCACGCCTGCAAGATCACACG
TCCAGATCACTCACCACCAGGCATTCTGCTGATATCCCCCGCTGCATGTTTTTCCGACGGGCAGAAAAGCAAGCAAGGGCAATCGTTGGTTCAAAGTTCG
AGTGATGAACCACCAGAGAAGAAAGTCTTGGTATCCGCTATGCGTTTCATCGTACTCAGTCCCAGTTAAATACAAGTGCCGCATCACGTTGTGCTGGCCT
TCATCCCCTGCGAATCGTTTGCGGTTGTTGTTGCTGCTTTTCATGCTGCCTGAGTCAACTCGACCACAAGACCCTGACAATCAACACCAAGCACATCGAC
GATGGTTGATATCTTTATTATGGATGGCTGATGGTTGATACAAAGCTAACTAGCTAGCTGGACAACGCACTACTACTAGAGGGTGACACGCATATAATCG
AAGCGCCAAGAGCGGCAAACACGCTAACCTGCGAATTCGTGCTGTCGCCCCTGGCGTCTTTTCGTCTACTTACAGCGCGTTGGCCGACTTCTGGCGTGCC
AGCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTGCGGTTCACGTAGTACACGCGGCCCGTAGAGCGCGACACCT
TGGCTTCCCAGCCGACAGGGAGCGATACCTCCGGCAGAGCATCCAAGTTAAACGACTCGCGCACAGGGCGATCCACTGCGGGTTTCGCTGCCGACTTCAC
CTTCGCGCTCTTCGAGGTAACGACCGTCGTCGATGCGACGTTGTCGGTCGTGCCCACCGTGTTGTCCTCAGGCTTGCTGTTCGTGCGCTTGTTCCGGGAC
GCACTCTCGTACATGCCCTTCACGACGGACATGCGGCCCTTCAGGGTTGACATGGCACCCGTCACGCCCACCTCCATGCTCTTCACGATCGTGTTTCGCG
TGGTAGCGTTCGTGGGGCTGTCCTCACCGTCGACCTCCGAGACGTCGAAGCCGTCACCGTTGTCGCCCTTTTTGTTAGAGTTCCAAAGGCGAGAGGCCAC
GCTCATGCTCGGCATGCGCGGGAAGTGGCGCTCCGACGCGCCCGACGAACCACGGTTGAGGTCATCCGAGCCGGTGAGCGAGTCCATCAGCACGGTCTCG
CGCGGTTTCTTCTCCTTCTTGGAGCCCAGCGTACGGAAGATCGACTTCTTCTGCGTGGACTTCTTCTCGGGCACGCCTTCCACGTGCAGCTTAGCAAGCT
GCTCTGTCAGCTTCTTGTTATCGGCCTCAAGCTGCTTGATCTTCTTGTCCTTATCTCGCACAGTGTCCTGCAGCTGACGAACCTTGACGTGGTTGCCAGC
CGAAGAGAACTCCTTGTCGCTCTTGAACTTCTCAATTTCCGCCTTCAAGCCCTTCATCGTAACCTTCATGTCCTCGTTCTTCTCACGCAGCTTCTTGTTC
TCGTCCGTGAGAGTCTCGATCATGCCACCAGCGTCAGCCATGACCACACTGGATGCAGCGGACGTCTCCGCCACGCTGCTGCGGCGTTGTAGTTGCGCAT
TACGCTCCTGCTCATCTTGCAAGGCTGCCTTCAGCTTATTCAGCTGGTAAGCCATGTCAGCCTCACGACGCTTCTCTTCAAGAGCAGCCCGATACTTCGG
CCGCTGGATCGTCATACGAACCACAGCCTGCACGCGAATAACCATCGCGCGCATCTTAACGTAGCGGTGGCGCTTGACAAAGCCACGCACATACCGCTGG
ATGATAACAGCGTTGTGGTTGCTCTTCACATCGGCAGCAAACTTGCGGCCCTGAATGCCTCGCCAGTGAGCTTGCGCCAAAGTAAGGCCGTTCAAGAACG
TGTTGTATCTCCGCATGGCGATAACGCACCGGATCACCGACTGCAACTTGATAATCGCTTCCAGTTGCCGTAGGTACTTGATACGCTGAGTGAAGCCAAC
CATGACGTTCTGCAGATATGTGGCCTTGGCATCGAGGAATTTCTTACGGCGGTCCTCGAGCTCTTCAAGCACACCCAGCTGGAAGTACACACGGGTCTTA
CCCATCTGGTACTGCGTGGGCGACTCCAACTTCAGCTTGTCCATGAGCAGCTGGCACTTGTCTGCCGGCGTCTCGCCTCCGCTCGGCACAAACAACCAGA
ATTTGCCCAAAATCTCCGTGTGCTGCAACCGATTTGGGTACGCTGCGCGCGAAATACGAATAGCCTCGATCACACCAGCGCATCGCAGCTGGGACACCAC
CATGGACTGGTCCATGACTGTCGCGCTCTTGATCGGGTTGGGCTTAATGCAACGCACATAGTGCACACGGGTCGAGTTGATGGTAGCCATTAGCTCCGTC
AAGCTTTCTTTGAATTGGGTACCGACCGTCGTAATCGACAGCGCACCACCACGCTTGCGGCGGCCACCAGAAGCGGCTTCTGCCGCAGTCGGCTTCGGCT
CCGGCTTCGGCTCGAAGAGCTTTGCGATGAACGGCTTCGACGAACCACGCATGAGCTCAGACAAGTCAGGCAGCAGCGAGTCCTTGTGCTTCTCCAGGAA
ACCGACCGAGTCGTACATGACAGGAGCAGCATAGTGCTTGATAAGGAACTCGGTCCGCGATGTACGAGGGAACTCAATAACGTGCGCCATGTCATCCTTG
TGCAGCGACGTCACCTTCGACATGAAAGACTCCTCGTTACCCTTAGGTCGCATCACCTCTTCGTTAAGCAGCGAGATGATACCCATGCGCGACTCAATCA
CGCTCAGCACATCCTGGTTATCCGCATATTCAATGTGGTCCCACACGATACCTTCTTCCTCGTACTCAATTTGCACGGTCTTGAACACATCCTGTGTGAA
CTTCTGTTGAAGCTTCTCATTGGCATAGTTGATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGCTCGAAACCGAAGATATCGAGCACACCCACGTGG
TTTGCCATGTTTGCATCATCGGCAAGCGACTGGTTGATGGTAGTCACCAGCCAGTCGAACACGTTGGAGTAGATAGCCTTGGAAAGTGCATCACGGCAGT
CCATAGCCAGTTCCTTGCGCAGCGGCACGCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTCTGAAGCGCTTCCCAGGTGACACC
AAGCATCTGAGTGGCAGCATTGGCACCACTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACTGCAGTTGCGCCTCACCAAGGTGG
AGCACACCGGCAAGCACCTCGAATAGCGGCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGTCTTCTTGAAGTGCTTCTCATCCG
AGAGTCCTTCGATCTTCTGTGCTGTGTTGTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGCGCAATGTCGGAGCTATCCAGCAG
CTGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGACACTTGGCACCAACAAGCGTGCCG
TTCTGGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAAGGACTCCAGCAGCGGGTTCACCT
CGATAATCCTCTTGATGGTCGAGTTGTTCATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTTTTACCAGCACCGGACTC
ACCACTCACCAGAATGGACTGGTTGATCTCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGTGCGGCGGAAGCTCCTCCTTGGGC
TGGTTGAGGTATCTCAGGTGCTGCTCCTCGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAATGTCGCCCGTGTAGGTGTACGGCA
GCTCGCAGAGGAAACGCTTCTTGACATTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCAATACCCTCGGGCCCGACGTTCTC
GTTCTGGTAGGGCAGCGACTCGAGCTGTTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAACGCTCCTCGGTTTCGCCGTCGGGC
AGCTCCACCTTGCACGTGATCTTGCGGATCTTGCCGTCGCCCGAGTTCTCGTCGCGAGCACCTCGGCTGCAAGCCATACGTGCGTCTCGTCTGGCACGAA
GCACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAGGCGGAGAGGTGCGCGGCTGACGG
CCCAAAGCGGAATGCGGCAAGGGGGGCCAACGCACCAAGGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAGCAACTCGACTAACTTGCGATT
TGTATGAGTTGCTCTGATCGGGCAACTAGAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTCGCCCCGTGAGGATTTGTGCAC
GCTGTGCCGGCGAGTAAAGGCCCGAATCGAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAATTGCGATGCGTGCTTCATGTGG
TCGCGTATCCCAGCCAAAGCTTCTCAGGCGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTCGTTTTCTGCTCGACATGATTT
ACCGCGAATGGTACCGGTTTTACTTATCTTGTCACACGGCATACCTTGTTCAAAAC