Description :
From Genome Similarity Track
Location :
contig_47:303865- 309421
Transcript NameFunction/comments
g9695.t1hypothetical protein
g9696.t1hypothetical protein

Sequence
5556 bases(100 bases per row)
TGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGATCCGCGCCGAGAACGAGCGCCTGTCGCGCGAGATCCACGCGCT
GCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGACGCGATTGAGGCCTCTGGCAGCGAGAAGGTGCAAACGCTGGCG
CACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCATGACGGAGATCCTCAAGAACGCAGACGCCCAGAACGAGGTGG
ACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGACGCTGCAGCGTGCCAGGGGCATGTCGATGCCGCGCCAGCGGCG
CTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATCCCACCCTCAGGAAAGCACAGCCCCGACGGGCCTCGTCCGCCC
AGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGAAAAAGAGTCTGTTGTTCTCCACTCACTCGCACTACGGCAACT
TCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGTTGCCTGTCCATCGCGTCGAGCCCACCCCGGCAAGAGAGAGAG
AGCACTACCTTATTTAACACCAACCCAGCATGTTCAGCCATTGGAGCAGCTAGCTATCCGTCTAGTCGAGCGTCGGGCGTCACGCCTGCAAGATCACACG
TCCAGATCACTCACCACCAGGCATTCTGCTGATATCCCCCGCTGCATGTTTTTCCGACGGGCAGAAAAGCAAGCAAGGGCAATCGTTGGTTCAAAGTTCG
AGTGATGAACCACCAGAGAAGAAAGTCTTGGTATCCGCTATGCGTTTCATCGTACTCAGTCCCAGTTAAATACAAGTGCCGCATCACGTTGTGCTGGCCT
TCATCCCCTGCGAATCGTTTGCGGTTGTTGTTGCTGCTTTTCATGCTGCCTGAGTCAACTCGACCACAAGACCCTGACAATCAACACCAAGCACATCGAC
GATGGTTGATATCTTTATTATGGATGGCTGATGGTTGATACAAAGCTAACTAGCTAGCTGGACAACGCACTACTACTAGAGGGTGACACGCATATAATCG
AAGCGCCAAGAGCGGCAAACACGCTAACCTGCGAATTCGTGCTGTCGCCCCTGGCGTCTTTTCGTCTACTTACAGCGCGTTGGCCGACTTCTGGCGTGCC
AGCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTGCGGTTCACGTAGTACACGCGGCCCGTAGAGCGCGACACCT
TGGCTTCCCAGCCGACAGGGAGCGATACCTCCGGCAGAGCATCCAAGTTAAACGACTCGCGCACAGGGCGATCCACTGCGGGTTTCGCTGCCGACTTCAC
CTTCGCGCTCTTCGAGGTAACGACCGTCGTCGATGCGACGTTGTCGGTCGTGCCCACCGTGTTGTCCTCAGGCTTGCTGTTCGTGCGCTTGTTCCGGGAC
GCACTCTCGTACATGCCCTTCACGACGGACATGCGGCCCTTCAGGGTTGACATGGCACCCGTCACGCCCACCTCCATGCTCTTCACGATCGTGTTTCGCG
TGGTAGCGTTCGTGGGGCTGTCCTCACCGTCGACCTCCGAGACGTCGAAGCCGTCGCCGTTGTCGCCCTTTTTGTTAGAGTTCCAAAGGCGAGAGGCCAC
GCTCATGCTCGGCATGCGCGGGAAGTGGCGCTCCGACGCGCCCGACGAACCACGGTTGAGGTCATCCGAGCCGGTGAGCGAGTCCATCAGCACGGTCTCG
CGCGGTTTCTTCTCCTTCTTGGAGCCCAGCGTACGGAAGATCGACTTCTTCTGCGTGGACTTCTTCTCGGGCACGCCTTCCACGTGCAGCTTAGCAAGCT
GCTCTGTCAGCTTCTTGTTATCGGCCTCAAGCTGCTTGATCTTCTTGTCCTTATCTCGCACAGTGTCCTGCAGCTGACGAACCTTGACGTGGTTGCCAGC
CGAAGAGAACTCCTTGTCGCTCTTGAACTTCTCAATTTCCGCCTTCAAGCCCTTCATCGTAACCTTCATGTCCTCGTTCTTCTCACGCAGCTTCTTGTTC
TCGTCCGTGAGAGTCTCGATCATGCCACCAGCGTCAGCCATGACCACACTGGATGCAGCGGACGTCTCCGCCACGCTGCTGCGGCGTTGTAGTTGCGCAT
TACGCTCCTGCTCATCTTGCAAGGCTGCCTTCAGCTTATTCAGCTGGTAAGCCATGTCAGCCTCACGACGCTTCTCTTCAAGAGCAGCCCGATACTTCGG
CCGCTGGATCGTCATACGAACCACAGCCTGCACGCGAATAACCATCGCGCGCATCTTAACGTAGCGGTGGCGCTTGACAAAGCCACGCACATACCGCTGG
ATGATAACAGCGTTGTGGTTGCTCTTCACATCGGCAGCAAACTTGCGGCCCTGAATGCCTCGCCAGTGAGCTTGCGCCAAAGTAAGGCCGTTCAAGAACG
TGTTGTATCTCCGCATGGCGATAACGCACCGGATCACCGACTGCAACTTGATAATCGCTTCCAGTTGCCGTAGGTACTTGATACGCTGAGTGAAGCCAAC
CATGACGTTCTGCAGATATGTGGCCTTGGCATCGAGGAATTTCTTACGGCGGTCCTCGAGCTCTTCAAGCACACCCAGCTGGAAGTACACACGGGTCTTA
CCCATCTGGTACTGCGTGGGCGACTCCAACTTCAGCTTGTCCATGAGCAGCTGGCACTTGTCTGCCGGCGTCTCGCCTCCGCTCGGCACAAACAACCAGA
ATTTGCCCAAAATCTCCGTGTGCTGCAACCGATTTGGGTACGCTGCGCGCGAAATACGAATAGCCTCGATCACACCAGCGCATCGCAGCTGGGATACCAC
CATGGACTGGTCCATGACTGTCGCGCTCTTGATCGGGTTGGGCTTAATGCAACGCACATAGTGCACACGGGTCGAGTTGATGGTAGCCATTAGCTCCGTC
AAGCTTTCTTTGAATTGGGTACCGACCGTCGTAATCGACAGCGCACCACCACGCTTGCGGCGGCCACCAGAAGCGGCTTCTGCCGCAGTCGGCTTCGGCT
CCGGCTTCGGCTCGAAGAGCTTTGCGATGAACGGCTTCGACGAACCACGCATGAGCTCAGACAAGTCAGGCAGCAGCGAGTCCTTGTGCTTCTCCAGGAA
ACCGACCGAGTCGTACATGACAGGAGCAGCATAGTGCTTGATAAGGAACTCGGTGCGCGATGTACGAGGGAACTCAATAACGTGCGCCATGTCATCCTTG
TGCAGCGACGTCACCTTCGACATGAAAGACTCCTCGTTACCCTTAGGTCGCATCACCTCTTCGTTAAGCAGCGAGATGATACCCATGCGCGACTCAATCA
CGCTCAGCACATCCTGGTTATCCGCATATTCAATGTGGTCCCACACGATACCTTCTTCCTCGTACTCAATTTGCACGGTCTTGAACACATCCTGTGTGAA
CTTCTGTTGAAGCTTCTCATTGGCGTAGTTGATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGCTCGAAACCGAAGATATCGAGCACACCCACGTGG
TTTGCCATGTTTGCATCATCGGCAAGCGACTGGTTGATGGTAGTCACCAGCCAGTCGAACACGTTGGAGTAGATAGCCTTGGAAAGTGCATCACGGCAGT
CCATAGCCAGTTCCTTGCGCAGCGGCACGCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTCTGAAGCGCTTCCCAGGTGACACC
AAGCATCTGAGTGGCAGCATTGGCACCACTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACTGCAGTTGCGCCTCACCAAGGTGG
AGCACACCGGCAAGCACCTCGAATAGCGGCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGTCTTCTTGAAGTGCTTCTCATCCG
AGAGTCCTTCGATCTTCTGTGCTGTGTTGTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGCGCAATGTCGGAGCTATCCAGCAG
TTGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGACACTTGGCACCAACAAGCGTGCCG
TTCTGGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAAGGACTCCAGCAGCGGGTTCACCT
CGATAATCCTCTTGATGGTCGAGTTGTTCATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTTTTACCAGCACCGGACTC
ACCACTCACCAGAATGGACTGGTTGATCTCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGTGCGGCGGAAGCTCCTCCTTGGGC
TGGTTGAGGTATCTCAGGTGCTGCTCCTCGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAATGTCGCCCGTGTAGGTGTACGGCA
GCTCGCAGAGGAAACGCTTCTTGACATTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCAATACCCTCGGGCCCGACGTTCTC
GTTCTGGTAGGGCAGCGACTCGAGCTGTTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAACGCTCCTCGGTTTCGCCGTCGGGC
AGCTCCACCTTGCACGTGATCTTGCGGATCTTGCCGTCGCCCGAGTTCTCGTCGCGAGCACCTCGGCTGCAAGCCATACGTGCGTCTCGTCTGGCACGAA
GCACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAGGCGGAGAGGTGCGCGGCTGACGG
CCCAAAGCGGAATGCGGCAAGGGGGGCCAACGCACCAAGGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAGCAACTCGACTAACTTGCGATT
TGTATGAGTTGCTCTGATCGGGCAACTAGAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTCGCCCCGTGAGGATTTGTGCAC
GCTGTGCCGGCGAGTAAAGGCCCGAATCGAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAATTGCGATGCGTGCTTCATGTGG
TCGCGTATCCCAGCCAAAGCTTCTCAGGCGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTCGTTTTCTGCTCGACATGATTT
ACCGCGAATGGTACCGGTTTTACTTATCTTGTCACACGGCATACCTTGTTCAAAAC