Description :
From Genome Similarity Track
Location :
Scaffold_1:30384- 31447
Transcript NameFunction/comments
Phyke_g142cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
1063 bases(100 bases per row)
GCCGCCAGGCTCATCGAGCAAGTGCGAGATAGAGTACTAACTAGTTAAAGCTACATGACGTTTCAGCGGAGCATTGGAAGCCTAAAGCGGCGCTGGAATG
AATAAAAGTGCTGGACTGCTCTTTCCTCCCAGAACCATTGAGTGTGATGTGGTGCGCTAGCGTAGACCAAGCGCAAAGACGGCGAGACATAAAGCTGAAA
GAAAGAAGGCAAATATGAATATCATAATCATAGGGCGCGTGTAGAGGAAGATAGGAGAGCACTATCAGCCGTCGCGGAGGCGATTGCAGCGCCAAACTTC
AGGTGAACATGAAGACATCACCTCGACTCGCAGTTCTTGTCGGCGCCAGCTTCTCCGTCGCTGGCACCGCGGTCCTTCCACTGCTACTCCTTGGTCAATC
CGTCCCTTTTGTTCGTGGAAGGCGTGTGTGTATAAGATGTATTGATGCGTCTGTGCGCTGTCCTGTTCTTCTGTTGGCGACTAAAtgttgttggcgatga
cGGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTTTTCTAACGGCCCCATAACCCTCTTGAACGTCTTGCGGTCCAACGTGAGGCACTTGACCTTACC
CTTCGCAGTCACAGTCGCCTGTCGTGGTCGAGTTGTGAGCAGTGCGATCTCGCCGAAGTACGCGCCCGATGTGAGCTCTCCCATCTCCACCGGCGATTCT
ACAGGTGAGAGCTGCTTCGTACAGACTGCCGAGCCCTCTTCAATAATGTAAAACAGGTTGCCGTCATCGCCCTGGGCGATGATGACCTCTCCGTCGCTGA
ACGTCTCTGTTTTGAGAGCGTCGGCAACCGTAAGACGTTCGAATTCGCTCAGCGACTCTAGCAGCGGCACGCGCTCAATGAAACCCTTGTGTGCCTCGCG
TTTCTTGAGCGTCGTCTCCATGATGATAAACTTGAACGTCTGACGATCCAATGCCCATGCCTTCGAGTGCTGTACCGCCTTCACAGTTGCTGCACGCGGA
GAATTGTACATCAACGCTAATTCACCAAACGACATTGCTTCTGTGCACTGCATcaccaaaaca