Description :
From Genome Similarity Track
Location :
contig_18:303804- 304825
Sequence
1021 bases(100 bases per row)
GACTCCGCCGGAGATACTCGCTGTAGTCTCGGAAGGACCAGTATCGCAATGCGAGAAGTTGCTCTCGCGTTCGAGGAGTCGCAGACTCGTGATCGCGCTT
CGAGTCTCGGCGCTGCTCGTGGCGACCTTCACATCTCGAGCGCGCTCGCTGAGATGTTGTCGGTTGTCGCGCTGCAGCAGCTCAAGCGGGACGTCGTCTT
CACTACAGACGTTGGTGATGACTTGCGGTTCCCGCTCGGTCGATGGGATTCGACGCGCAGGCTCGGCCTTCGCTCGCTCCGTGTTGCGCTCAACGGCAGC
CTTGCTGCGAGGAGTCATGGGACTCCCTGGATGGAGAGCGCGTTGCTGCTCCGTGAGCTTGGGGAAGCATTGGGGTCGTTGACCTCCCCTTGCTCGAGTC
CCTTCTCGGATCCGACTCGTCGTAGTCGACCTCGTTCGAGACGTCCTCCGGAGGCGAACGCTTCGCGTCCCGAATCGGGCCTTGATCAACCTCCATCTCC
GTGACGGACGAAGTCCGATCGGCGGCACCTGCCCATCGCCCGCAGGTTGCGAATCAGGGGCGTCGTGCGCTGTGTGAGCCTCTCCTTCGTTTGTCGAGTC
CCGCGGGGCACCCGGCTGGGTTTCATCAGGCGTAGAGGCCGCCACTAGCTCTTGGAGTTTCCTTGCCGCTGGCCGAGGTCGTTGGAGGCGTTGCCGTAGA
TGCCGCGGCGTGTGCTGGTCGTCCGCTCCTGGAGCCTCCTCCATGTCGACATCCGGGCAATCCTCGTCGCCAAGAATGAGCCCAGGGTTCGTACAGTCGG
TGTCCGACTCGCTGCTGCTGCTGGCCTCCTGCGGACCGGGCAGCTGCACCGCTGTGCGCTTGCTGCTGGATCGGGACTTGGTCTTGGCAGGCTTGGCTCG
AGAGGGCGGATCGCCCGGCTTCTTGGAAGCGGATTTTGCTCTCGGGTGTTTGGGAGGCTTCTGCGCCTGGGCGGCATCGCCTTTCTTCTTGGCATCGGCA
GCGCTACGCGCTTTGGCTCCG