Description :
From Genome Similarity Track
Location :
Scaffold_193:3037- 5430
Transcript NameFunction/comments
Phyta_totarag5365hypothetical protein

Sequence
2393 bases(100 bases per row)
GTAACCTTTCCAGTGCACTAGCAATTCTCGTCGCGCTCGTCCGTAGCGTGTTCGCCGACCAGATCGTACTTCGGTGATGTGTTTAACCTCgtactcgtct
tcgtcaaaTTCAGTCTCTCAGCGACCTTCAGGCAACAAGGCCTCATCAAATCGGATCGATCTTGGTCTTGGACGGCTAGTCGAAGACGCGGACAGTCGAG
GAAATCTCGCACGGGCTTAAGCTTAGACACGTGGATCATATGGAATAAGTTATACGCGGTGCCACCGAGTTCTAGCCGCACCGCGTgttcgtcgatcttc
tcggccaCTCTGAATGGTCCATTCCCCATGTGCGCTAGCTCCATGCATTGCCTTCCTTCACCCTGTCGAGATGCAGCCAGACTTGGTTGCCGACTTCAGT
CTCGTGCGGACGCACCGAGCCGTTATGATGATCTGTCCTGATCTGGATAGCTTTGCGTAGGTACGCGTTTACTTGCTCACGCACCTGCTGGTAATGCTTC
TGAACATGCTACCGCCACCTTCGAAGGTTGCGATCTCGGCGGCACGTCGATACTAGTCGGTCATCGCTTCACTGTCGATCTTGGGTCCCATCCAGATAGA
AAGGCGCGTCGCCGCGTACTCGATCGTGAGCCGTGTTGATGGCAAACGTGAGACCCTCTGCAACTCATCCTAATCCTTCTAGTTGACGTCTGCGACGTAc
atctgcagctcttgcgtcagcgtctgcaccaTCCGTACCGTTGCCCTATGATCTTGTTGAACGTTCTTAAGAAGTCGGACATAAAGCCTGGCTCTCGATC
ATGCCTGATCCTTTTACTGGCGCCAAAACATCGGAACAACGCACTCCTCGTAATTCTCCACAATCGTCTGAGCAGTTCTTGATGCACTTGCCTTGGCGAT
AGCAATAATTCGAGATGGATAGGTCGCCTGCATCTTGCCGGGCGACTCACCTCAAACAGTTGGCCTCCCGTTTCCAGTCTCACCGTCTATGCACTGATCC
ATGTAGCGTTGCACAATCTGATACAGTCCTCTCCAGCGGAAACGCATCTTGATCCGATGGTGCTTCCTCCCGATACCTTGTTGTACGCCCTCCAGGCAGA
CATGATAACGCTGTAGGAAGTCTTCATGCAGCGTTTCCGGAATCACCAGTAGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGGCAGGCAGACAGTA
AACCAACAAGCCTTCCGCATCGATCTCGTAATCTTCAGCATGCTTAGCGCTAGTCTTCGAGATAAGATCCTGCACGTCTCCACGCAAATACTGCTTGAGA
CCGACGATCCACTTCTCTTCGTCTTATGCCATGCGCATTTGGTCTTCCCTCATTCGTTTAACAATCTACTCCTGTAGGACTTCTGGGCTGCGTCACCGGC
GCGATCTCGTCACGGAGCTGTCAGATCGTGGAACTAGCATCTCGTCGAGCCGGCTTAGTGTCCTCAAGTCTTGGAAATCATCTTCTGGTGTCACTACCGT
GCCTCCGTCATACTGAAGAGCGGCACCAGCGAGTCGATCTGCGCTTTGGTTCCAACATCGCTACACAGGCATGAATTCGTGACTTGGCCACGATCTCAGG
CGCTCCATAGCCTGTTGTCGTAGCAATTTCAACCCCGGCACCTTGCACTCGATCTCAACTCCATTTGTCAGATGACCAAATTCGAATCTCCGCAGATAAA
AGGCCGTTCCCTGTCCAAtacggcaagaagatcgaagcATAGCACCAAGCCGTGTTATTCCGCCTCGTTGACTGTCAGATTGTCTTTGCCTTGTGACGAA
TCCGAGATCACTTTCCATTCTGGTAAACTCCATACAATCGTGCTGTGTGCTCCTCCACTTCGCTTTACTCGAGCTGATCCATCGAAACTGACCACTACCA
GCTTCGCATCCGCCACCAATGTAGGTGGCGGCATGGTGATCACCAGGTGGGGCAGCTTCTGAGGGCTATCGATAACAAGATCACCTCGACCTCTTCACGT
GGTGTGATGCTCGCGGCCATTACGTCTAAGagctcgtcctcgccgtTGTCGCACTTTACGATCTTCAGAGTCCAACTCTACAGCAGCGCGGCCCAGCGAC
CGAGTTGTCCTTGCAATCGTGATGAGTGCAATAGCCACGTCAACGTGGAGGTTTCTGGTCAGCACCTTGACCGATCTCGTCAGTAACTGCGTGTAGCAGA
CACCCAAGATCctgagcagcgcgagaaccTCCTTGTCGACAACGATCTCGTTTGTCTTGAGCGCCCGGCTAGTAAACGTCACCGGTTCATATATGCCCCC
TTGCTTTTGCATTAACGCAGCCACAATCGCCCACTTACTCGCATATACCACCTCTACCGGTCTTCGATCTGGATCGAAGTGCTTCAAGACAGG