Description :
From Genome Similarity Track
Location :
Scaffold_1156:3037- 4195
Sequence
1158 bases(100 bases per row)
GAAGCTGCTGCGACAAAAGACGCGAAATGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTG
GCTGGACAAGCTCTGCAGCGTCAAGGAGGTCGCAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGAC
CACGGGCATCGAGTCCCGAGATGGCGTCTCCAGCCAGTCCCGACGCGGAAAATCGCGACGCGGAAAATCGCGACACGAAAACGCGCGGCGCAGATGACCC
CGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGCCCGTCCT
CCAGAAGTCCTGGAGGAGCGGGTGGTGCAACGACTGCGCCTGGACCGCATCCACGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATC
TCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCACCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACTA
GCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCGAGC
CTGGAAGGCGGACACCAGGGTATTGGCCCCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGACG
AATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGA
CCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCATCA
CGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTC
CGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTGCTA