Description :
From Genome Similarity Track
Location :
Scaffold_16:303678- 317585
Transcript NameFunction/comments
Phyra_76141ferric reductase, putative
Phyra_76142dehydrogenase
Phyra_76143Hypothetical protein
Phyra_71393endomembrane protein 70-like protein, putative
Phyra_76145Hypothetical protein
Phyra_94392PREDICTED: uncharacterized protein LOC101862085
Phyra_94393cell division protein ftsZ

Sequence
13907 bases(100 bases per row)
ACTGCCCACGTGTTTAATGAGGTCTACCTGTACCTGGTCGCCACACCGGACGAGGTCAAGCGGTCGATCTTTGTGACGCGGCATGTGTCTTCCTTCGTGA
ACGGAGAGCGACCTCCGTTCACTACTATGCTGCAGTCCCTCCCAGTGTGGACTGGCGCGATTCTTCTGGTCATCACTTGTATCTCGTTCCCTCTTGCTGC
GATCCCGAAGTTCCGCCAGGGCAAGTTCAACCTTTTCTGGTACTCGCACATGCTCTTCGGGGTATTCCTCGTCGTGCTGTCTTTCCACGGTGCTGCTTCA
TGGCTCGCTCGCTGCTCCTCGTACATCTGGATCACACCTCCGTTCCTGATCTACCTGATTGAGCGTCGCTTCCGGTACGCCAAGATGTTTGCTGCACCTG
TGCGTATCATGGAGGCTATGGAGCTGGATGGCACTGTTGCTTTGTTCATGGAGAAGCCTCGTCGTTTTGTGTACCGACCGGGCATGTATTTGTTCATTAA
TTGTCCGCTCATCTCTTCTCACGAGTGGCACCCATTCACGATTTCATCGGCTCCGGGTGACAACTACATCAGCATTCACATGCGCGTCTGTGGTGACTGG
ACTCAAGCCATGGGCCGTGTCATTTCGGACTGCCACGAGCGCAAGGTGCTGTACCCGGACATCTACCTAGATGGTCCGGTTGGTGCTCCAACACAAGACT
ACCACCGCTACAAGACCGTCATCTGTGTCGGTGGTGGCATCGGTGTTACCCCGTTCGCGTCGATTCTGAAGGATGTGGTTCATCTGTGGGAGGACAACCG
TTGTTCGAACTGCAACCATGTTCGTCACCCGGGCTCCTTCAAGATCCAGAAGCTGTATTTCCATTGGGTGACCCGTGGACAGGAATCGTTGAGCTGGTTT
GAAGAAACAATGAATCAGATCGCCGAAATGGATCGCGATAACGTGATCGAGACGCACCAATACTTGAGTACGCTGAAGGGCAGTGAGAACACCTCGCAAC
TCAAGATGTTCCAGGAGTTCGTGCACGAGCAGACTGGCAAGGATTTCGTGTCTGGTCTCAACACTAAGCAGCTCACACACTTCGGTCGTCCGGACTGGGA
CAAGGTCTTCTCCGAGGCCAAAGCCAACCACCCTGGAGAAGAGGTCGGTGTTTTCTACTGCGGCCCTCACGCTCTGGAGGAGATTCTGGATACCACATGC
AAGCGGTATTCGTCCTCGGACCCCAACGGAACCATCTTCGACTTCCACTCGGAGAAGTTCGCATAGATTTAGCAGATATACGTCGATAGTGTGCTCGCTG
CCGAGTAGAGGGCAGTTCTGCGTCTTTGATAATCGTAAAGTTGAAGTGCAATAGTTTTGGCTGCATAACTTTCCTCGCGTCAGGATACCGTACCAGTACC
GGTAATACAAACTTGAACAGGAAAGTGCCCGTCAAAAGTTGGCATTGAGATACTACATAGTACTGCGTAGTAATATCAAGAAATACATATAATATTATAT
AATACAATATAATAATATATCAGTAGTACTTCAGCGGCTATCCCATTGGTCAAAAATGCGCTTTCTTCCAAACCTCAACTTGCCGCTAAAGGCAAATCGA
GATGCCCAAGAAGCTGCTTGTCATTGGCGGCACCGGTGCGCTGGGCCGCGGCGTGGTGTCCCTTTTCGCGCGTGCATCGTGGGGGATCACGTCCGTGGGC
TTCACTGCGAACGAGGACGCCCACAACAATGTGCTTCTGCCCAAGAGCAACTCGCTCAAAGAGGCGCTACAGACGCTGCAGGAAATCTCCAGTAGATGCA
GCCAGGTGGACACTGTGGTGTGCACAGCCGGCGGTTGGTCCGGCGGTAGCATCCGTGATGCGGACTCGCTAGTGAATTTAGGAGAAATGCACTCGAAGAA
CCTCGAGTCGGCTTTCCTGGGTGGGTGATAGCGAGTGTGGTGAGAGTTGGTGGACGGCTAACAGTTTTATGGTTGGCTGACTCGGTAGCGACGTATTTGG
CGAGCCACTTGCTGGTACCGGGAGGACTGCTCGTTCTGACGGGTGCAACAGCTGCACTGAAGGCTACGCCGGGCATGGTGTCGTATGGGGCTAGCAAGGC
GGCCACGCATCACTTGGTGGCTAGTGCAGTGTACGTCTCGACAGCTTCTGCTGATGATCACAGACTAATGGTACTTTTGTATTTTGTTTGCATGTACTCA
GGAGTGAGCTCCCTGAAAATTCGTCTGTGCTGGGCGTTCTCCCGGCGACAATCGACACACCGATGAACCGTAAGTTCATGGCCGACGCAGACTTTTCTAC
TTGGACGAAGGTACGGCAGAATGTCTGATGGTGATTTGCGGACGTGATTGAGTTCACGTTTATGATTTTTTGAATTGCAGGCAGAGGACATTGCAGAGAA
GATTTTGGAATGGTCGAACTCTCCCTACACTGCTCGCCCACCGAGTGGGCATTTGGTCACTGCAACCACTGAGAACAACACGACGTCGTGGAAAGACATT
GGCAACTCGTTTCAGTAGATGGGGTTGGCAAACAATGTAAGGGCAAGGAGGGCGAGAGTAGTATCCCTTAAAATTATCCGGCCATCTCTCGATTTACGCT
TTCAGTTCGCCCAGTTGGTATACTTTCCGAATCGTGCCGGAAGGCAAATTACTGGAATCTCTTCTTACAAAGGAATCGCGTCCCCGTTCGCACTGTTGGT
AAGGTTGCGCTTGAAGTGGTCGCAGAACGTGTTCAGTACGCGCCTAAACTTGCGCGAGTTTTCGACACATGTCGGTGTGGAAATGTAGTTGAGGAATTCG
GTGCGCGCTCGCTCGCTAACTTGCGAGCCCAAAAAGTTGCTGTCGGACAGAAGCCGACGAATCAATTCTTCACTGCGCTGCCGGCCAAAGTAGACCCAGC
AAGACCGAACGACCTCCGCAATCTTCTCCATCAAGTTCGGTGACATGCCTCCTGCCGCGGCGTTAAACAATGCGAAGAGCAGGTGGTACTGCACATCTTT
CTCAAAGAACAGTGTCTGAATCTGCTGGTGAAGTAGTAACTTGCCTGCGAACTCGGAGCCGTGAAGCAAGGCCTCTGGGGTGCGAAGGATCTGGCCATAA
AGCGAGCCTAACTCCAAAAGGAAGTCGAGAGTTGCAGCTCCGACATCGGGATTCTGTGACTTGAAAGCGTGTAGCGCTAGCGCCAACACTGCCTCCAACT
GATTCGACTGTACTAAGATCGACGGGTGGTGAGTGCCGCAGGTGGTTACAAGAGAAAACAGTGCAATGGTAAGCCCTGGATGTTCATCAACGCTGCCGTC
TGTCGCGATCTTGCTTATTGAGCTCTCGCTGACAATCACCATCACACGCGTTAAGCTAACTGCTGAAGCCTCGTCATCACCAGCACAACCAATGATACTT
CTGATCACGCTTAGATAGCTGCCATCATAACTACGCGAGAACTGCTCCAGTAATGCTGGCATAATCGCAGATGCTAGTTCCAACGCTTGAGACCGCAACG
ATTCAAATACTCCGACTAGAAGCGCAGAGAACTGCTCAACCACCTCCTCACTGCAACCGTACACGCGCAAAATCGTCTCCACTATATCCCACTGCTTTTG
CAACACACACAGCACTGGGTGTGAAATCTCCTGGTCCATCTGAAGAGGGACCCTCGTAGCTAAAACGTGAAGATGATTAAACATCTCGCACAGGAACTCA
ACCGAGCTTTCATCATCCGCACTTAGTTGGTTAAAACGAGATGCAAGATCTGCAAACATGATGATACCGAGTTCCTCCACCACTGGGAGGGCATCCTTGT
ATGATACAGTCGAGAGAACATGGCAAATTGAATCCACGATGAGCCTGGCACTATCCCCTGACAAGCATGGACTTGACGGACTGCCTACTGCCGCGCGATT
CGAGCGATACAGATTTACCAATGCGTCCATCCAAAGCGGGTTGAAGAAGTGTGAGCCACAACGAAGCGTCAACTTGCGCAGTGCCACTGCACCGACATGA
TCTCCAAGACCGTGCTGACTGAACGGAAATCCGGGATCATCCTGGGTGAGCTCGAAGCCGTTGGACACTATCTTGAAAGCGCACGTTGACAGGAATTCAG
GGTGTCTTGCGAACCAATGGCCGGTCATACCAAGGAAGATAATTATCGTGCGTGAGAGTGCGCGGTGAGAGGGCTCCTTCCGCGACAAGCATTCAAAAAG
CCTAGGAACGAGTGATGTGTCTTCTTCGCGAATCGATTTTGACAACGCACTCAGAGCGTGCACATACACTTCTGTGCGTTGCCACCACTGCACACACACA
AAACGAAGACCCAAGTTATAACAGAGTCAGTTCACCTTACCAAGCAAACGTATTAAATCAGCAGCACGTGATCGTGATGGTAGACGTACATTCGGTGGCA
GGGGAGCTCCCGAATCGGCGGCTTCGTACTGCTGAAAGATCGCATGGATGGCATCGACAATAAACTTGTCCTCGCTAGCAATCGTGACAGTAGCAAGTGC
GCGGAAAACATTGCGAACTTCACTTCGGTACAGGAAAAAACGCTCCTTGGTTGCTTCCGGATAGGCTTCAAACCCCTCGGGATACTGGGTGCGCTCTATC
AAGATGATCAGTATTCGCGAGATGAATGTCTCAAACACGTACATGCGCTGCTCGTGCTTGCCAGAAATGTATGTGCGAAAGTCAATCCAGAATTCCATCG
TTTCGTTAGAAATGTCCAAGTTGTTTAGCGCCGTGAAGAACAAGATTGTATCCAAGAACTCGTACACTAGGGATCCCGGTCGCATATCCAACGTGAAGTC
CACAAAATACACGACAAAAGCTTGCCCGCATTCGGATATCGCTCTAGCGCAGTCAGCAAGGCAAAAGTCTGCGCTTTCTTCAGAGGTTGCTACACGCTCT
TGGAGGTGCTTTCCGAGCACCACGAAATTATGCATTACAAGCTCCATCAGCTGCACATGCTCCTCGTGACGGCAGATACGCACCACTTCGCGTACAACCT
GCAGCGCGAACACCGAAGACGCGGGGACCAATGTTTCACGAAAAGCACGATCTAGTAGCCCGCACTCGATAATAACTGGCGGGGATACTGTGCCGTGCTC
CACCCAGCTCGCAAATGCTTGCAACAACAGACTACGCAACGGTACCTGTTCTTCGCTTGCGTCAATGGCAGTGGCAATCGACGGTAGAACTGTCCGAACG
ACATGCGCCGCACACTGATGCACCATATCCTCACACCGAACACGCTTGACCTTGGAGAATTTGACGCGCTTATTTTCCACTTCCTCCGGAATAACCTTCA
ACGTTAGCAGCACAGCAAAATTGGTTAATGTTGCTGTCGCGCTGTCGCTAACCGGTTGCTGCTGGTTTTGAACGAGCCATTCCACAGCGCCGACCACGGT
AGTGTCACCCTGGGGTTCATGAAAGCGAAGCAGGATGACTGCTATAGTAAGTGCCAGGTGGGTCTGCACGTTCAGCTCCTCCTGTGTGCCATTGGGCCCA
GTCAACACGTTCCAGACGTCTTGCGCCATCTGACCAAAGTCCTTCACAAGCGCCTCGTGGTGAGCGCGATCCTCAGGCGTCCAATTGGTTGGGTCGTCCA
TCTTGTACTTGCGGATGTACGAGGCCACAGTAAAGTAGACCGTCGACGCTGAAAACGCGCGCTTGGCTCGCAACAGCGCATTGTGCTCAGCGTTCCCCGT
GTCAACGATTTGCGCCTGTAGAACGGCCAACGCCGTTTGTGCAGCTTCTGGCGAGCGCTGGAACTGCTGCAGCAGCGAATCTGCGCGTCGTCGCACGCGC
GGCGAGCTCAATGGGCTGTAGAGCTGGTGTAGCGCCTCGGATACCACAGCTTCTGAGACCACGGCGATCTCCATAGCTCCCAATAGCTTCGACTAGCTGC
GTCACGGACGTCTCGTTCCTCTGGTGGTTGGTTCTTGCTTTCGCAACTGTCGGCTAATGTGGGGCCAGCACCTACTTAGTGTCGACGGACAACAATAGAC
CACGAACACCAGATCCAATTGGGGCCTATGGCTAATCTAATTGTGGCAGAAAGCGGGGCTGGATCGACGCAGGATCAGGTCTGCTTTTGCGCAAGTGCTC
GGTCTTGCCTCTCTGGAGTGACCTTGAGTGCGCCGTGGCAGCTTCAACTGGAGCGCGCTGCAGTTTTCCGCTTTTGCCGTCGCGAGGGGTTCCGACACAG
AACAGAAATGAGAGGTTTCAAAACCGTGTGTGGTACATTAGAATAAAGTTTCGTGTGGTGCACACTACGTCGTGTCGTGATCTGATTCGCGGTGGGCCAC
TTTTGTCCAATGTCGTGTCTGCGATTGCCTCTCCCACTGTCGTATTCTTTTCCGCAGGTCATTTTCCAAGTGTTCCCTATCACTTTGCGCAGGTATTGTT
TCTGGCGTCGGCTTCGTGGCAGCTCAACTCCTCACACTCCCCAACCTCGAAGAAGCCAGACGTCAGGCGGCAGTTAAGTTCCTTCCTTCCTTCCCTCCCT
CCCTCCGAGCTACAATGTGGATGAAGAGCGTGGCACTGGCTGCGCTCCTAGCGGTGCAGGAGGCCAGTGCGGCCTTTTACGTGCCTGGCGTGGCGCCCGA
GGCCTGGGCTGCGGGCGACGCTGTGCGTCTCAACGTGAACAAGATCACGTCCACCAAGACGCTGGTGCCGTACGAGTACTACTACCTGCCATTCTGCAAG
CCCACGGCCACAAATGAGCAGCAGGAGAACCTGGGCGAGATCATGGCCGGCGACGCCATCATGGACTCGCTCTACAACATGCAGATGGAGAAGGATGCGA
TCTGCCAGGTGCTGTGCAAGCCAATGACGTACACGTCCGAGCAGTCGCAGTCCTTCATCGACATGATCAAGGACGAGTACTACGTGCAGTGGGTGGTGGA
CAACCTGCCTGTGCTATACCGCGACCCGACGGACTCGCAGCAGGCTGGATCCTTTAAGCGCGGTTTCCCCGTGGGTGAGGTGGACGAGGACGGCAAATAC
TTGCTGTACAATCATGTGCGCATCATCGTCTCGGTCAACTCGGACCCGTACGCTGAGGAGGATGGCGACGTCCCCAAGTGGCGCGTCGTCGGCTTCGAAG
TCGTGCCCACGTCCATCAAGCACAGCTACGAGAACGAGCCCATGGCCGGACAGGAGCTCGATTCGGACACATGCGGCAAGTTCGTCAACATTGAGGAGGT
GTCGCAGGGCAACTACCAGTATCTGAACCCGGAGGGCGAGACCACAGTGCTGTACACGTACGACGTGCAGTTTGTCAAGTCGGACATCGTCTGGGAGGAA
CGTTGGGACCGCATTATCAGCAGCAAGAGCTCGAACGACCAGATCCACTGGTTCTCCATTATTAACTCGCTCATGATCGTGCTCTTCCTCACGGGAATGA
TCGCTATGATTATGCTGCGCACGCTGCACCGTGATATCGCGCGCTACAACGAAGTGCAGACCACGGAGGAGGCACAGGAGGAGTCCGGATGGAAGCTTGT
CCACGGCGATGTGTTCCGCCCGCCGCAGCTTTCGCCCATGCTTTTCTCGGTGGTTGTTGGCACGGGTGTTCAGGTGTGCTCCATGAGCGCCTCGACGATG
CTTATCGCTCTGCTGGGCCTGCTGTCGCCGGCCAACCGCGGATCGCTGCTTACGACCCTGCTGCTGCTGTTCGTGTTCATGGGCAGCTTTGCCGGCTACC
ACTCCTCGCGTACGTACAAGATGTTCAACGGCAAAGACTGGAAGAAGAACACCATCCTCACGGCCGTGCTGTACCCGGGTCTGCTGTTTGCTGTGTTCTT
CTTGCTGAATTTGGTGCTGTGGGGCAAAGCCTCATCTCAGGCTGTGCCGTTCGGTACGCTTTTTGCGCTGCTTGTCCTGTGGTTCGGTATTTCGGTGCCG
CTCGTGTTCCTTGGCAGCTACTTCGGCTTCAAGGCTGCGGCCATTGAGCAGCCTGTGCGCACGAACCAGATTGCGCGTCAGATTCCGGAGCAAGTGTGGT
ACCTGTCTTCACCATTCAGCATCCTCGTGGGCGGTATCCTGCCTTTCGGTGCTGTGTTCATTGAGCTGTTCTTCATCATGTCGGCACTGTGGTTGCACCA
GATTTACTACGTGTTCGGCTTCCTGTTCATCGTGCTGCTTATTCTGGTGGCCACGTGCGCCGAGGTGACGGTCGTGATGTGCTACTTCCAGCTCTGCGCA
GAGGACTACCGTTGGTGGTGGCGTTCGTTCCTCACCTCGGGCTCGGCTGCTGTGTACCTGTTCCTCTACTCGTTCCTGTACTTCTTCACGAAGCTGAACA
TCACGGCGTTCGTCTCGGGCATTCTGTACTTCGGTTATATGTTCCTGATCTCGATCACGTTCTTCTTCCTCACGGGAACCATCGGCTACTTTGCTTGCCT
CTGGTTCACGCGCAAGATCTACAGCTCCATTAAGATCGACTAAGTTGGCATCAAGTTAGCATTTCCCAGATAGCACAGCACTGTGCGATGCAGAGAAATA
GCGAGAGGTGGCGGATAGCGAAGCAGCAACGAACGGAGGTCCCTGGCTGGTAGATATGTGACACAACCGCGTGGAGCGGGTTGCCTAGCGTCATATCCAA
GCCATGCATGTGTCGTTTGACACCTCGTGCTGTGTGTAGAAGACAGAAAACCAGAAAGCGAAAGAAAAATAAATTCATTTCGTTTCAAAAGCTGTGGCCA
TCAAAACAACATCCGAGCGCCCCGCTATCAACAGAATCAATTCACCGACCCGCGTGCCTACAGCGTGCACCAGTCTGCCAGCCACGGGTACTCGTCGACC
AAACTCTGCGCGCGTCTTCGCCAGGAGTTTACTGATTCCAGAGATCGGCCAGGAGCATTGCCGAGAGCCTCCAAGATCAAGTCGCTTGGCGTGGCTAACA
GGTCGGCAGGCGTACCGAGCTTCTGGACTTCCAGCCGTTGAACTACTTCGACCTCACCGACAATTTCCGACATCCAGTCATTCACCTCGTCAAGGCGAGC
CTAACTCATTCACAAATCACGAGTAGTCAAACGTTAGTACGCTGTCAGCAACACACTTCATCATAGTTTCACTAACCTCGTCGATCAGGTTTTCAAGTTT
TTCCTGCAATGTCTGAGCCGAAGGGTCCATCGGATCCACTAGAGCATGCAAGGTGGAGCCCACACACGCGTCCGCAAGCTGTCGACGAGTGGTAATACCA
GCCTTTTGCAGCCATTCTGCAATAGAAGTTCCCGCAATCTGCGCTAATTCGTCGTCGATGGCATCGCACCCGCTGCGTCCAGTCTTGGCTAAGTTGGCGC
AAGTCCACGGATCCTTATCGAGCTCAGCGTTGGTGGCTTCTTCAGGTGAAAGGATACGCGCTTTCTTGCAAGAATCGCAATAAACTGTAGTGGCTTCCTC
CACCTCCTCCTCAGACTCTGTTTCCTCGTCGTCGCTTGCAGCATGCTTCTCAGTTGTTTGGGCAGTCGGCGTCTCCTCCTTAAGAAACGCGGATACAACG
GCACTTGATTGAGCAGTGCGATCGAACCGGGCTAGAGCCGCCCGCGCCGCTGCACTACGTAGAGTAGTAGGAGTCGCCTCTTTAGCTGAAAGAGCAAGTA
TCTGGGCAGCTCGCTTAGGCTCCGCAGCCTCTTGTTTGACCTCTTCTTCATCACTCATGCCCACGTTAATAACGTCGGTTTTCTTTTCCGTGGCCGCAGT
TCGTCTGCTTTCTTTCGCCGGTGGCTTACTTTCTGTCTTCGGGGACGACACTTCACCACCCTGGACTTTACCCTGCTTCCACAACTTGTACTGTTCTTCA
TTTTCCTGTCAAGTGTAGCAACATGAATTGTTACAAAACTGGCTTATTCGGTAGCGTAGCATGCAGCCTAAAATGCAGTGCATTGTACCTGTGCCTCCAT
CGCTTTCTCAGACAGCACTCTGTATTAAGCAAGCAGCACGCAATATTATGTTAGCAAGATGGTCCACGTTGCAAACAACATTTTGCCGAGCTTACCGAGT
GCGAGTGTCCAAGAATGACCAATCTTCGTCAGGCACGAGGTCTGCCAGACCAGCAGCCACATCTCCATCATACAAACGTGCAATGTTCCAAAAGACCCTG
GTGGACACCTGGGCCATGTTAAACGGCTTTAGCATCTCGCGCCCAGTCTCACCGCCCGACAGCAACACGTATTTCAAAATGGCCTGCAGCTCGTCTGTCT
TCAGCAAATCCACTGTTTCCTCTTTCCACTTGCGGGGAGTTTCCTTAAAACGAATGCGCAGTTTAGCAGCGCTACCGTCACCACGCCGGGTAGTTGATAG
CTCTTCGATTTCAAAATTGCGGGCCAACGATGCATTCAGTCTAGCGGTGGCCAACGTCAGCTCGTATTGATGCTCCACCGCGTTTTTCGTCGCCGCACGA
AAAAACTTTGATGCACGGTCGTGAGATTGGCCGCTCACGGCGTTCACCAGACTGACCTCCACGTCCTCTTTCGACGTGAGGTTGATCGCACGGCTACGGC
GATATTTGTGCTGTGGCTCCTGTTCATCATCGTCAGCCCCCGCAGTCGCTGCATCAATTGGATTGTTCTCCAGCGAGCTTCCAAGCTGGTGTCCGCTGCC
TGGGATTTTCCGCTTCGGTGCGACCTTCTTCTTCGCGCTGGTCGGTGGGTGTAGCGTGTGCACCCCGCCTCTTGGTGCTTTCGCTGCTGCTTTCTTTGCA
GCTGCTCGTTTCGGTCTCGCCGAAGCCTTCGCTTTTGTACTAGACGCAGCAACTTGCAGTGAAGCTGCAGATCCAGCGTTCGTGTCCATCACCACTGTGT
CGTTGGGTTCAAAGACGGTCTTAATAAGTGCAGAGCCGTCCACTTCAACCGCTCGAGGCGGAAATCCTCTGCGAACTGATACCCGTGTAGCAATAATTCA
CTGCATGTCAGTCCCTAGTTGTTGTAACCAACTCAATGCATCGCCTATAACGTACACGTCGGTGTATCCTTGGCTTTCAGACCTAATTGCTTGGCCGCCA
GTTCTTCATAACAAAAAAAAACACAATCTTGTCAGGTACCCGCCCAACGTCAAGCCCAGCATCGCTACGTACGTGAGAACGTCTTGAAGTCGGTGTCTGG
GTCAATCTGCAGCACCACCTGCTTGCCGCGCGGCCCGCGCAGACGAACGCTCCACATGGGCATCGCCGCCGTTGGGAACCTTTTGACTTGGCTCGGCGCC
TGAAGGAACTTTCTAGGAACACGCGCACTGGTCAAGTCTCTAGCTTCTGATCTAAACGACCCACCAATCACGTGCAGACTAATTGATAGACGCTCACAAT
CGAACTTTCCTTCTGGAGCCGAAGTTGACGATGGCAGAACTGAGCTGGCAGCAGAAGCTGGCGAGCGAGACGGACGCCGCCAAGAAGGAGTGGATGGCGC
TAGAGCGCCGCTACTACGTGGAGCTGGTGAGCGAGGATGCCACGACGCAGGACATGCGCGTGCGGCTGTTCTTGAGTCTGTCGGATCCGGAGCTGCCTAC
GCGACTGAAAGGCCAAGTGGAACTGCAACTGACGCTGCCTGGGAAGTATCCGGTGGAAGCTGTTCACGTGGATTTTACGCAATGGAGTAGCCGACTATCG
GACGAGCAGGTTGACGCTTTGAATGCTGCGGTAAACGCTCGAGCTCAGCAGTTGTGTGGAGGTTACTCGCTGAGGAAGCTGCTCACCTGGATCGACAATA
GCTTTTGGCGCATTATTAAGTCATTCGAGAAAGAGGTGGAAAAGGAGCAAGACGCGACCACAGATGGCAGTGGCCAGGCATCAGATAACGGTGTTCAGGA
TGAAGAACTGACGATGTCTGTGGCAGAAGAGGTGTCTTGTAGGATTGGGAAGAAGCCGAAGCGAAGACGCGGGCGACGACCCTGCCGCTTTTTTGCCAGA
GGTAACTGCAAGGATGGCGAGAACTGCAACTTTTTGCACGTGAAGAAGCAGGAAAAAGTGATGGAAGGCAGTGGTGAAGAAGTGTTTGAAACGCTCGATG
AGGGTGCTACCTCAGTTGTTAGGGAAGCTGACCTAACGCAAACATCCGAGGCATCAGCAACTGCGCCAGTACCAGAACCAAAGAAGAAAAAGAAAAGTCG
TGTGCGGAAGTGCAAGTTTTTCGAGCAGAACAAGTGCCGCGATGGAGATAAGTGCAAATTCTCTCATGAGCTCAAAAGTGCAGGGGCAGCCAGCAAGGGC
CAAAGGCATGACGCTGGCATTCCGACACGAGCCGTTGTAGTTCAAATGGGCTCTCCGATCAGGTCCACGATGACAGCAGAAGACAGCAACAACTCGGACA
CAATCGTGAACAGCACTACAGACGAACCTAAGGATGGGAATCATCAACACAACGAAAACAGCAGCAAGTGGTCAGAGGAGCAACAGCGTGCGCTTGATCT
GGCATTGAAGAAGTATCCGCCATCGATGGACAAGAAAGAACGATGGACCAGTATAGCAAGTGAGGTTGAGGGTCGGACCTTGAACGAGTGCATCGACCGC
TTCAAGAAGTTATGTGAACTCGTGCGCCGCGGCGTGGACCCCACCGTTGCCGCAGCTACCGAGAAAGCTATGGAGGAGGAAGAAGTGGAGGCACCTGAAG
ACAACGGCCAAAACGTCAAAATCACTCCTCCAGAGAAGCGTGTCGCCATCGAAACTGAACCTGAAGCGAAGGGCACCCAGATTGCTCTCGAGCATCTGTT
TCTGCACGAAGTCGGCACGCTTGTCGCTCATCGACTTGTTTGCCAGGTTCAATGCGATAACTGCCCACTCAAGTTCGATGCCATCTTGACCTTGGACTCG
ACAGAGATCCAGAAGTGGTGCCCCAGGTGTAGCGTGCTTCACCACGTGCTTATGAGACCTGTGTTTGCTCACTCACAGAGTAACGTGCTGGCCTATGTGG
ACACTCAAAACTGTTCAATTGTTGACGTGCTACCCACCGACGTGCTAGCTACTTGCCTGGCGTGCGGATGTGAAGCTTTACTGGAAAGAATTACACCGAG
ACAGCGATCAGAGCAAGCTTGCTTTGCTTGCCATGTCAAGCTTGCTGTGATGGCAAAGCGCTTCGTGGCTGGGCAGCTGGAGGGATCAAGCGGTAAACGG
GGTGTTTCTCCTGATGGCACTGCAACAAAGACTACCAAGAGCAACAAGAAGGGAGGCAAGCAGGTCGTGGAAACGTTTGTTCTGGGACAGCCCCTGCCTC
ACAATGGAGTCTGTGATCACTACAAGCATTCCCTGCGCTGGTTTCGCTTCCAGTGCTGCGGCAAAACGTTTCCGTGTGATGTCTGCCACGATTCGAGCGA
CTGCCCCGAAGCCAACCTTGGAAAATTTGCCAGTAGGATGATTTGTGGCCTCTGCTCGAAGGAACAGTCGAGCTCGGTTAAAGTGTGCTCCTGCGGCAAC
GACGTTGCGTCAAAGAAATCAACCTCTCGTCACTGGGAAGGTGGCGCTGGGTGCCGAGATTCGTTGCAGATGTCGCGCTGGGATAAGCAAAAGTATCGCG
GTCAGAACAAGACGGAGAGCAAGAAGTTCAAACGGGTTGGTGCGGAGTCCAAGAGGCGCAGAGATAATGCGAATGGAGACGCTGACGTGCAACAGTAGAG
CATTGAACGCATAAGATCACTAAATTGATTCTGCTATTCTGAGCTGGAGGCTCGCTTCTCTTTCTCTCAGTTTTTGTCTTCCTAGATCATGGTGCACTAC
ACGCTGGCTGGGCGAGTAAGTAGTGAGGAGTATGCTATCTGCGACAGGCTGCTTGGTAACGAATGTACCTCCTCGTGTTGATCACTTGCATGCGTCTAAC
TGTTCCGGTGTTTGTGCAGACATTTTGGCAGCGACGCTGCCTGATTGCCAAGTGACCAAGTTGCCGTCCAAAACCGATCGCTGGGCTAACGATGCCGCCG
AGCTAAT