Description :
From Genome Similarity Track
Location :
contig_5:303649- 307469
Transcript NameFunction/comments
g1342.t1hypothetical protein
g1343.t1conserved hypothetical protein
g1344.t160S ribosomal protein L15-1
g1345.t1hypothetical protein

Sequence
3820 bases(100 bases per row)
CCGCCGTGCGCCAACGAGAGTTGGTCAGAATAGAAAAACGACGATTGCAGTGACATTGTCGCCGCTACCCCTTTGCAGAGCCTCGTTGACAAGAACTTGC
GCGGCTTGAGATTGCTGGGGACGGGTATGAATCCCACCATATCCACGACTTCTTGGTCACTAAGAACATCCCAGACGCCGTCGCATCCCAGCACGATAAA
GGGAAGTCCTCCGCCGGTTCAAGTCTGGAGGAAATACATTTTAGAAGGCAGCCGTTGCGACGTCAGATACCATGGTGCAATATTGGCTCTCGGGAGATAT
CTTTACCTCGTCGCGCTGGTGTGCGGCCTTGCGATCACAACCTGTTTGAGATTTCGGTCTCCGAAGCTCCTGCAATCGATCAGCCCACGTGAGATTGAGC
GCGTTAAACGACAAGACAGTGGGCAGGGCATTACCGGGTAACTGCAAGTACACCAGACACGCGATCTTGAATGACGAAGCCGCCGTGTTGAATAATCCGC
TCCATTTCGTCCTGGTCATTCGCTTTGTGGTCCTGCAGAGCATCAATAACAGCCATGAGCCTCATCGTTGCATAATCAATAAGTATCCTGCTCTACCTTC
GAGAGTCGAACTGCTTTTCCCTTGCAGCTAAGCACAGCCCGACTGCACGAAGCACGCCATACAAGTTAGCACCATTGGCCTGCAGCATCTTACTTTAGTA
TCCACGCACCTATCGCCAACATTGGAGACGTAAAGTGTCCTTGCACAATTCTTCTCAAGCAGCAACGCTGTCACAGCCGTGGCGCCCACCGTCCCCGAAA
AAGACTGGCAGCATTCCATGTCGGAGACCAAGTAGCCCCTACACAACGACCACGTCAGTAACAGCACTTATAATACCATCAACAACACCCAGCCAACTTC
AGTCCTTACCGTTCAAGGCGCTGCTCAACTGTGCTTCCATCCTCGGCCAGCTGCAGCTCCGTCGCGATGTTCTTGTGTAGCACTCGTTGCAGGCACGTCG
ACACGGAACGACCTACACAGCTCTTGTCAGTTCGTTAATTACGAAACTATCCCTAGATCGCACTATTACTACTAGTATTATAGTAACAGTGCTCCATTAC
CTCCATGTCCATCGTGGATAGCGAAATAGCCGTTCTTCGGGTGCTGCAGGAAGCCATCCACGATGCGGATCGTGTCCTCCATCGTCTTCCTGTGTCCAGC
GTTCTCCACACGACATACGCAACGTCAGCCGACACACTAGCAGCCTCATTGCACATATTAAGCAGGCTATACAACTCACCATTTCCTCGCAGACGCTCAC
GCATCTGCAGCAACTGAAGACCCCGTCCATAATGGAATCGATTCTGTTCAAGCTTAAGTGTATCGAAACGATTGCGCCTTTTCAATTGTGTCCAGTCTGA
GTCGCAGTCCACAAGAAGCGCAGTACCGGTATGAGTCGTCCGCGCGTGAGCATCGCGGCTGTGGCGCTTTCGGCGGTCACGGGCATGACGGCGGCGGCCG
TGTCCATGATGGCGTACTATCGCTTCCAGCACCCGCAGGAGTTCGCGGACGCCAGCATCCGCATGACGCACCCGGAGGTGTCGGACGATTTCAACCGCAG
ATGGGGCCTCTTCGGCACGGGCGTCATCGACTCGGTGCCGCAGAGCATCAAGGACGTGTTTGACGTGCCCGACATGGCCGAGCGCTTCGAAAAACACAAG
AAGAAACGCGAGGAGCAGATCCACCAGATCGTCGAGGACCTGCGCCCCAAGGGCAAATAGACGGGCAGCCATAATTTCTACTGGCAATTGGACTACGATG
GAGACAGAAGACGCGTAAGACAGACCGAATCAAAAATAACAATTAAACACCGAGTCTCGGCAGCAAAGTCGCATGTATTCAACTTGTTCTTGTGGCTCTC
ATCAGCCAAAATGCAGCGAGTCTCCAGAGAGCTAACGCTACACTTACGAGCGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGGCGGAA
CGACGAGCCGATGATCTTGTTGGCACGGTGGCCACGCTTGCGGAGGCCACGGCCCTGGCGGCCGGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGTGC
ACGGCGTTGGCGATCCAGTTGATGCGCGGGTCGCGACGGATGACCTTGTGCGAGTGGTCGACCATGATGATCTCGAAATACTTGTACGTAGCGTCCTGGT
TCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGGCACGCTCCTCAGCCACCGAACGCAGGTTGCGCTCGAACTTGAGCTCGTTGAT
ACCGTGGTGCTTGGGCTTTCCGTACACGATACCCTTCGAGTTCGGGCGCTTGCGGCCACCGCGACGCACGGCGACGCGCACAATGACGAAGCCCTGCTTG
GCCTTGTAACCAAGGCGGCGAGCCTTGTCCACGCGGGTGGGGCCCGTCACGCGGTGGATGACCGGCAGCTGGCGGTACTCCCAGGCGCGCACACGCAGCA
GGAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGTACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAAGGAAATGCTCCGACA
TATTGGGCCACCAGGCCAGGAACGTGCCAGCCCCAGCCAGTCATTCACACCAACGGTCCCGCTAAGTACGACCGAGGTTAAAATGGGATGAGTCAATAAA
ACCTTGTTCGTATTTAAACAGGATGTTTCGTGTACCCCACACTACGACTGCTTGAAGTTGGCGCTCCGGATATTCGTTGTCGTCTTCATGGTGTTCACGA
CGATGCTGTTGCGCACTACCGCAGCTCTGCAGCAGACCGGCGGCCGCTGGATGAGCGCGGCGGCTACGACGGCCACGCAATTCAAGCTGGAGATGCTGGG
CGGCAAGGACGCGGGCATCGCGCTCTTCACCATGGACCGCCCCGAGACGCGCAACGCTCTCGGCCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGGAC
CAGGTACGCTACGACCCCAAGGTCCGCGTGGTAATCGTGCGCAGTGTTGTGCCCAAAGTCTTTTGCGCCGGTGCAGATCTGAAGGAGCGTCTAGGCATGT
CGCCTCCGGAGGTACGACGACTCTATAGCTTGCGCATGCAGGGAGGTGTTGACTGGGGCGTGATACTGCAGGCTGCCGCTTCCTCCCGTGGCTATCGCAC
GGGATTCACCGACTTGGAGCAACTTCCGATGCCGACGATCGCCGCTATTGAAGGAGCTGCACTTGGCGGTGGCATGGAGATGGCGCTGGCGTGCGATCTC
CGCATCGCTGGCGCTAAAGCCATCCTTGGGTTTCCAGAGACGTCTCTGGCCATTCTACCTGGAGCAGGAGGCACCCAACGCGCGTCTCGCCTCATTGGTA
TGGCCACCAACTTTTTGTCGTCCTTGCTCTTAATTGTTGTACATGTACTCATCGTATCATCCTCGCTCTTGCCCCGCAGGCATCTCGAAGGGCCAAGGAG
CTCATCTTTACGAGCCGCCGCCTCAACTCGGAGGCTGCTGAGAAGGTCGGTTTGGCCGACTACGCCGTGCCTGAAGGTAAGGCCTACGACAAGGCGCTCG
AGATCGCGCGTGAGATTCTCCCCAACGGACCTGTCGGCGTCCGCATGGCCAAGGAGGCGATCATGAGGGGCTCTGAAGTGGACATTGCTACGGGTATGGC
TATCGAGAACGCTTGCTACGCGCAGGTGATCCCGACCAAGGACCGCATCGAAGGTCTCGTCGCTTTCAAGGAGAAACGTAAGCCGCAGTACAAGGGCGAG
TAAGGCCGATCCGTCGCCTT