Description :
From Genome Similarity Track
Location :
Scaffold_18:303630- 305688
Transcript NameFunction/comments
Sapdi_VS20SDRG_06602hypothetical protein

Sequence
2058 bases(100 bases per row)
CGCTTCTACGCCCAGCGCATCTACACCAACACGGGCCACATTCTCCTCGCCGTGAACCCGTTCGAACGACTGCCAGGGCTTTATGGCTCGGAGCGCATGG
AGACATACGCGAGCTACTACGCGCCCGACGACAATCGCACTGACGATGGACGAGCAGCACCAGCGCCGCACATCTACCGCGTTGCCGCTACGGCGTACCA
GGCCATGATGCGCGGCAAGCTCTCGGACGCGCCGAGCGACCAGTCCATCTTGATCAGCGGTGAGAGTGGGAGCGGCAAGACCGAGTCCACGAAGCTTCTC
ATGGAGTACCTCGCACACGTTGGCGATGTGCCAGCGCCCGTGCGCATGTCGATGCCCGTCAACACGTCGACGATCAGCGACAAGGTGCTGGACGCCAACA
TTGTGCTCGAGTCGTTTGGGAATGCTCGCACACTGCGCAACGACAACTCGAGTCGGTTCGGGAAGCTCATTCAGATGAACTTTGACCACGGCCTCTTGAC
AAGCGCCTCAATTCAGACGTACCTTTTGGAGAAAGTCCGTCTCGTGACGCAGTCCAAGGGCGAGCGCAACTACCACATCTTTTACGAGATGCTCATGGGC
AGCTCCGAGGTGCAGCTCGCGTCGTGGCGCCTCATTGCGTCGCCCGAGATGCGCCTCAGCGTCGACGCGCGGCGGCAGCTCATGGCCAACTTTCGATACC
TCAACCAGACCGACTGCTACGACCGGAAAGACCACGCCAACGATGCCCACAACTACAACCAGATGCTCCGTGCCCTTCAGATGATTGGCTTCTCGGCCCA
CGAGCAGTTGGGCATGCAGGCCCTTCTTGCCGCGGTTTTGCATCTCGGCAACCTCACATTTCAAGTCGCGCCCAAGGACCACTGCCACGTCGCCCCCTCG
AGCCAGGCCGCGCTCGCGGCCGCAGCGACCTTGCTCTCGCTGCGCGACGCTGGCGCGCTCGAGAAGGCACTGGTGACGCGAACGTTCCGCGTCGCGGCCG
AGACCAAAGTGCTTCGGCTCAGCGTCGACGAGGCCAAGAACACCCGCGACGGGCTCACGAAAGCGCTGTACGGGCGGCTCTTTGAGTGGCTCGTCGGGCG
CATGAACGCCTTTCTGCGGCACGACGACCGGGCGTCCGGTACGACCTCTTGCCTCTCGCTCAGATCTGATGTCTGACTTCTGATCTAGACAATGCGTCGT
CGTTTGGGACGAGTACGAGCCACGCGGCGTCGAGCTGGATCGGCATCCTCGATATCTTTGGCTTTGAGGTGTTCCCGCTCAACTCGTTTGAGCAGCTCTG
CATCAACTTTGCCAACGAAACGCTGCAGCAGCAGTTCAACTTGCACAACTTCGCCAACGAGCAAGTCGAGTACAAGAAGGAGGGGCTCGCGTGGGACTAT
GTCGCGTTCACCGACAACAAGGAGTGCGTCGACCTCTTCTCTGCCAAGCCCTTTGGCCTCTTCTCGCTCATGGACGAAGAGAGCATGCTGGCCAAAGGCA
CGGACGCGTCGCTCGCGTCCAAGCTCTACGCCCGCTGCGGCAGCCACGTTCGATTCAGCGCCTCCCGCGTGCAGCAAGGCCGCGGGCTCTTCTCGATCGA
CCACTACGCCGGCCTCGTCGAGTACACGACCGTTGGCATCCGCGAGAAGAACAAGGACGAGCTGCGCCAGGACATCGTCGACCTCTTCCAGACTGCGACG
GCCGAGTCGTCGTTTGCGCGCCTCTTGTGCGAAGCCGGGCTCACGCACCGCCGCAGCAGCCACGCCACATTGCGCCGGCAAGAGTCCAAGCGACTCAACA
CGGCGAGCGTCGGCGGGCAATTCAAGACGCAGCTGCTGCATTTGATGGAGATGCTCAAGCTCACGGCGCCCCACTACGTGCGGTGCATCAAGCCCAACGA
CGAGGCGGCGGCCCATGTCATGACCAAGGACCGTGTCGCTGAACAGCTGCGCTGCAATGGTGTCCTCCAAGCCGTTCAAGTCGCGCGCGCCGGCTTTCCC
ATCCGCATGCTCCACGCCGAGTTCATCGGGCGGTACACGGTTGTCGCCCGCGCCAGCG