Description :
From Genome Similarity Track
Location :
Scaffold_55:30361- 31849
Transcript NameFunction/comments
Phyci_312248Hypothetical protein

Sequence
1488 bases(100 bases per row)
ATGAATCCGCTTAGCTAACATTCAGACGACAGTGCAGAACAAGCTGACCGCCCTCGGACGAGCTCggaatccacatcaacagcgaaccaccgcccgaacc
gggcagtccaaagagacccggacgccagcggtccaggtacagcgtcttatcgcccagctccttaaccgtggatgtccaagttgccttcgcgccagccttc
accttgattgaggcaatcttgtcacctcccgacttgatcaccacagacacgtcctcggagtccacactctcgaacagaagcgtcacagtgccgtcaccct
tcttcttccagataccgtagctacccaggaaggcctggtccacggtggttagacccagagcatcgtacagagtgccgtcgtcaatctcgccgaggtactc
ggtaggaccacagataggctgcacaaactcggaggccatccaggcaatacccgtggggtcgaacacggacagaatgaacagacccaggttcgagtactcg
agggccttctccttcttgactacgttcttgcccatgtccgtcgtgccgtcctcgacaatttggtcgacgatgacacccagcgtcttgcgcagtaggttgc
gcgtgctgtacgaggacgcactcgtcttgttggtccagatctgacccatgcagtggttcgtgaccaccggaatgtccgtcttgatgatagacgactcact
caccgcgacgcgcacatcgttagcggcagcgttcggggtgttgttacggacctcgtacaccttgcccatgacgcggttcgtcagggtcctcatctcgtag
ccgcacgtGCCGTTCTTCGAGTTAAGGAACGAGGACAAATCCAACGTATTTTTGTCCAAAGCAGTCGTGTTAAGGACTCCAGACTCACGCAGCATGAGCA
TCACGTTGTCCGACGAGGCGAAGATGGCCTCACCAACCATGACAGCCATCATGACGACAGCAGACACAACAGCAAGAATCGTAGCAGAGAACATGAGCTT
GGGCGGAATCTTGAGGCCGAAGCAGGCCGAAATGGCCATGGGCAGGTCGAGAATGACAATCTGGAGCTGGAAGGCCTTGTCCATGAGCTTTTCCGTATCG
GTCGTCGGAATCGTGGTCTGCTTGTAGCGCAGGTAGTAGATGATCGACTTGACGGCGTTGACAACGTTGATGGCGCACGTAAGAGCGAAGTTGGCGGCCT
TGTAAGCAGACACCAGCGTACCGAAGACACCCAAGGTGGCGGCGTTCAGAGCCACAGCAACCACGGAGGCAACCTTCGAGATGATTTCCTGCGTGCAGTC
AGCGTTTTGAGGAATGCACTCCATCAAACAGTCGAGGGGATAGTTTAGGGGGCACTGGGTGACACATTTGTTCTTGTCCTTGTTGAAACCCGATGGACAC
GTGCCCTGACTGCTGACGCCGAACCTCTTCTGGTAGCAGGCATTGTCGGAGGCAGTCTCAAGAGGACCGACCCAGTTTCGGATCGTGG