Description :
From Genome Similarity Track
Location :
Scaffold_27:303581- 311912
Transcript NameFunction/comments
g6612.t1hypothetical protein
g6613.t1hypothetical protein

Sequence
8331 bases(100 bases per row)
CGAAACGGAGAAGGACACCAGTACCACGAACTCCGCGGTCATTGTTGCGCCCAGCATCAGACTCGTGAACGGACCCACACTGTTGAGCTCAATCTTGATA
GCCATCACGGTCGCCGGCGAGCCCAGCACGGAAATGGAGCCGAACATGAGAGCAATACCCAATTGACAACTCAGTGCTAGTTCGTCGTAAAAGAAAGCGC
TCTCCACCATCAAGTGCACGGATGTCAAGAGCACCATAGCCGTCACGTACAACGTGCCGAGCAGGATGAAGATAGCCTTCAGCTGCGGACGAAGCTCCGG
CAGATAAATCTCCTGTCCGGCCTGGAACGAGATGAACGACAGCGCCAGCGCGCTCACGTAGTTCGACAGCATGTTGACAAGGTCTTCCGTCAGCAGGTTC
GCGACGAACGGTCCGGCGATGATGCCGATGACCAGGTATCCCGTGATGAGAGGGAGCTTGAAAAACTTGGGGAAGAAGAGTCCGAGCGGGTGGGCAGCAA
CCAGCACGATGACGAAGGCGAGCCCATATCGTAGGGTCTCGATGATGTTGCCCCAAGAATTGAACGGCACGGTTTTGTCCGGGTCTTCGGCGGCACCACC
GCTTAATCGACGGTCGATGCTTTCAGGACTCTTACCCTCCCGCACTGTTGCTTGACCCGAGGCAAGGTGCGCCGCAACAACCACTAACAGCGCTAGTAGC
TGCCTCGCATAGGCGGGAGTGTGGCGCGGTGGCATCGGACTTCTTTGTCTGCTTTAATCCAGACAGTAGAGCTCGATTAAAATGTCGACGGCGAAAGCCA
GAATGAGCTTGAACTGCCGTGATGTTCGTCGTGACGAGTTGGTTCCATTAACACTCTTGGGATCGGGATTGGGCGCTGAAGTGTCTGCGATGCCTCGAAT
TCCTGATCGTCTATCCCTACATCCGTCAACCCGACGAAGCACCAGCCATGCGTGGACATCCTCCACCTTCTTGTGTGTTCGGCAGAGTACATGTATTACG
GTTAACACCGAGAAAAGAGGGAAGCCCGAGCCACAGCTCGGCCCACATGTAAAGGACGGTATCGTATGGAATACGAGCTTCCTCATCTGGCCGTGCTGCC
CTCGCTTCCTGTGGGCTCTTCGCGGTGACAGACTTACCTCATCCAGTGTTTCAGCGAGGAGGTTGTACATGCATTATTAACGTTCGTAAACATGTGCAGT
ATCAAGGATGGAAACCAAGGGGCTATCCAAAAACTTCGACTCAACAGGTTTTCTTTACATGAACTTACACGTAGGGGCAAGCCACGTCAACGATGTCCTT
GGTCTACAAACCGACCACAATAGTTTTTTAATCTTTTACGTTGAAGTTGATTGGTTTGTCTGTTAATTGTAGTCCGAGCGAGTTCGACCAACCGGACGCT
TATCGGCGGCGCCTCTGCCTCCCCCTCGGCGCATACCCACGCGGCTAGCTCCCACCTGAAGTGGTGATCGCTGAAGGCTTAGCCTTGAGTTTCCACGTGA
CGAGTAGGGTCCGTACTGGGCATCCATAACGATCTCTTCAGTATCGTCGTGTTCGTCGTGCATGACGAAAAAGTCCGACGCATTGGCTCTACTTGCAAAC
GGGTCGAATCCAGCAGCAGCAGAGGTACCGAACATGGACACACGAGAAGGCGGAGGAGGCATTGGCAACCTCTGCGATTGCAGTGCCTCCGCGACGCGAT
CGTAGTCCACCGAGTGGTGGTTCACCACGTTGCGACCCAAGGCCATGCGACGGCCCTCCAAACGCATGTCCCCTAACTCACCACCATCATTGCGCAAGAA
GTACGACGCCGTACTGAAGTCGCTCGTCGTGCTGATCTCATTCGACAAAGCCTCCGCCAACTTCTGCTCCAGCAACGCCATTCGAGTCGCGATGTTCGCC
AGTGCGATCGACGGCTGGATCACCAACACGCCCTGCGCCTTCATCTCCTTGCTGAACTTGCAGTCCGGCACGAACGCGATCATCCGCGGGTGTGACGCTC
CCAGCAACGACTTCAACAGATGCACGTTCTCGCGCGTGCGGTTCGCGTCACCCGTGAAGATCAACACGTCCGCCGCCGACATGGCCTGAGCATTGTCGCG
ATCCTTGAGCGTGTTCTTGTACGAGATGAGATCTCCCTTGGCGGTGCGCTTGAGGATGGTATCGTTCATCTTCTGCCATTTGCTGGTACGTTCTTCGTCC
AGGAGGGGTACATTGACCTGCGCTCCGTAGAGTGAGAGCTCGAGTGCGACCTCGAAAGCGACTTCGTCGTCTCCGATGACGACTGCGTTTTGCACCTTGT
AGAAGGGCAGCAGTGATCGAGGGTCTCCGTTGCCCATGGTCACGTTCGCGCTTGACATTCGTCCACGGGTAACCTCGAATTGGCTCATACCTCCCCCGTG
AATGCTACTAAAGCCGCCGCCGTGAATGCTGCTGACACCGCCTCCATGAATACTTTTATCAATGCTGTCCACGTCACCCTTGGGCCTGTCGGCACCCGCC
AGTCGGTCTTGCAGAGTCTCACCTGCTCGACTCAACCCCATGGCACACAACACAGGACCCACGATCTGGTTCACCACCACCGCAGCCACAATCGTCGCCG
AAAACTCCGCCGCCCACGACTCGTCGCTTAATGCCTTCACCTCGTTGGCTAAACCCAAGGCCACACCAGCCTGCGGTGTCATTGTCAGCCACAGGTTGTT
GTACTGCTGCGGCGAGAGCTTCAGCAAGAAACGTCCGCCGAAGTAGCAAGCGATGAAGATGGCCACATATCTCATCACCACGTACAGACTCATGAGCGGA
ATGGCGGCCACCACTTGATCCAGCTTCAATGCCGCACCCGTCATGACGAAGAACGGCAGGAACATGTACGGCGCGACCGTGTCGAGGATGACGTGCATGT
CGTGGCGGATGGCCGAGTAGTGTCCGGCGATGCACGAAGCGATCATGAGCACGAGGAGAGGCTCGAACTTAATCTCCCATGACAGACCGAACGCTGCGGC
AGTGGCCTCGGCAAGAAGGGTGGTTGAAATGTAGAATACATATCCCATTGACAGCCAGATGAAGCCCTTGAGCGATAGTGCTGCCTTGGGCGACAATGGT
CCAGAGGGTGTGTGCTGAAGTTCGTCCAACGTGCATTCGTCGGCTCCGTTGTGCGGGTGTGGCTCCATGTCAGGGTCCGTCGACTCCCCCTTTTGATCCG
TTCTCTGGTCGTAGTATGTCGAACCGGGTCTTGCCTCTTGTCCGTGATGCGGCTCGCCTCCCGGGATTTTAAAGATCAGAATAATCAGAGCAGCTAGGAT
GATACCAACCAACACGTTAGACAACACGATGCTCATTGTGTACGCCAGGTTCAGCATGGACACGTCCAGCTTGGCGCAGTAGATGGAGCACACGATACGC
GAAATCGAGAAGGACACCAGCACGATGAACTCGGCCGTCATTGTCGCGCCCAGCATCAGACTCGTGAACGGACCCACACTGTTGAGCTCGATCTTGATAG
CCATCACGGTCGCCGGCGAGCCCAGCACGGAAATGGAGCCGAACATGAGCGCGATACCCAACTGGCATGCAAACCCCATGTCGCTGTAGAAGAAGGATTC
CTCCATGATCAGGATCGCGAATGTCATGATGATCATGGCTGTCACGTACAGCGCACCGAGCAAGATGAAGATGGCCTTCAACTGCGGACGAAGCTCCGGC
AGATAAATTTCTTGGCCGGCCTGGAACGAGATGAACGACAGCGCCAGCGCGCTCACGTAGCTCGACAGCATATCCACGAGGCCTTCTGAGAGCAGGTTCG
CGACGAACGGTCCGGCGATGATGCCGATGACCAGGTATCCCGTGATGAGAGGGAGCTTGAAAAACTTGGGGAAGAAGAGTCCGAGCGGGTGTGCGGCAAC
GAGCACGACAACGAAAGCGAGCACATACTGCAGCGTGTCGATGGCGTTGCTCCACGAGTTGAACGGCACGGTTTTGTTCTTGTCGCCCGCATCTCCGCTT
AGACGGCGGGTGTAGACATCGACATCGTTGTTTTCTTCCCGCAGTGCAGGGTGACCCGACGCTACTTGCAAGGAGGTGGCTACGACCAGCGAAAGCACGA
GCATAAGCACCGTCGACTGCGGTGCCGCTGGCAGCCACCTAATAGTGCAGGCACGGGTAGCCTGGCGGGGCATCTCCTTGAAGTTAATCGCTTTGAGCTC
TGCTGGTTGGTTGAGCTGTCGCTGGTAAATCCTAGAATGGCAAGTGAGATTGTTTGGTAGGAGAACCGATGGCGGCACACGTGCTTGGTCAAGCGATTGG
ACTCGGACCGAATCGCACGAAGATGGACTGCATCCCGAGGATAGCGGGACGACAGAGTCTGGCTCCACAGGACCAACCAGGCAGACAGGACCACGAGTGC
ACTGTCGATGCAGGTCACCTGTTGCGATAGTGATGACATTGAAGGTGCAGACAAGTTAATCATGCGTGGAGCAACTCGCTTAATCCCTGCAGATGGTCGG
GTTGCTGGCCTGATGTACCCAAGGGGCAGTGCCACAGGAACGGCGAGCATTTGGTCATTGTACAAACCAGTACCGGTAGTTTGAAACCACGCGTCGCGCT
CGGTTGCACCGTGGATTATGAGTAGTAACTCCTATTGTTTCGTGAAATACTTCAGTACATGCCAGCATTGGTGTGTACCGTGGTGACTTTACTTCTAGGT
ACATGTGCGAAATTCAAGGGAAGAGTGAGGACAGTATTCGGACAGGGATTTGGAGGGACCAATATTTGTGTGGCGGCCGACGCTGAGATGGCTCTCCAAA
TCCCAGGCTTACGAGCGCTTCCTCGCTGCGGAAGCCAGCACTTCGTCCTTTCGCTAGAATTCCTGTGGAATCGACGCAAAATGCCGCATAAGCATCGTGT
AAACAAGATTTCGTACATGTATTACACTGTACATACATGGTACTGCTGTGGCAGTTGGTTTTGCGGACCTCGGAGATACAAAATGTACAAGATACCGTGC
ACGGGCCGATCGGAGGATAGTACATGTAGCGGGTATACTCGTCGCACAAGGCGTGTGACACAGCAATTTGTTGAGCCACAGCGTTCGCGTCGACCCCCAT
TCTCGTTTACTAGTACAGACAATCCTCTCCTTTGTGATAGCGTCGGGAACCACCACATTATCACTCGCTGGAGTTATTACAAGGCAGAAATGTGCCGTAA
AATTGGTACATTTGAACTTAACCGCGGTTCGTTTGGGAGGTTGGGAATGGTTGGTAGACCCCTCTCTCTCGACAGCTGCTGAACCCACCGGACGAGAACA
TCCTCGCGGATGAACCAACGGACGAAGATTTCTGCCGGGTCGAGTCTTCAGAGCGCGAGAATGGGTGCGGTCAAGATGTCGGTGATGGCGGTATCGAGGA
CGAAGAAGAAGAAAGCACTTCTTCAACCTATCCAACGCCCGAAAACCTGTCCACAGAGGAGCTGAAGGAGCGTCTTCAATGGATAGCACAACTTTTCGTT
ACCGCCGGTGCGATGGGGGTCCGTTCAAGGGACGTTATCGGGCTTCGAACGATGCAGCGAGTATTTAGAGAGGAGCTTGCGTGTAGACAAGGCCACAAGC
AGCAAAAGTCGATGCTCGACTTCTTCGGACGTCCTGCACCAAATGGACCTTAGCAATAGTTAAGCACCTTTGAATAGTGATAATGACGTGTTTTGTATCA
CAAACCAGTAACTAGAGGGTAGAGGTATATTTGACTCGTGCTTGTATGGTGACGGTCATCGGGAGCCCTCCCCATATCTCTCCGTGGAGGGTATCACTAC
TCAGGATATCACGACCGAGAGGATTGTCTGTACACTATAATAGCTCCGATCCGTGATGATGGCGATGACGCCCACTTGCCAACTGCGCTTAGTACCGAGG
GGTGATCAGTGCAAGCTGAGGAAAGCTCGCCTCGACATCTTACCGAATGTGAGTTTCCATGCCATTGTATGAACAACCTGTATCGCTTTTCGTCGAGAAT
AGACAACCGCGTAGGTGTACCCTCAAGTTGCAAGCCTCGATCACCACCAGTTCTAGTGCCCGCCTGAGGACTCGAAAAGCAGTGTATCCATCCAATCCCA
TCGGACCAAGGCGGCTACTTTACTGTTTGAAAACGCCTACGGGGCGGACCTCAAGCAGTATTAAGACGATGTAGTTGAAGCGAGCCGAGTGAGACTCAAC
CTCCACAAGCCACACGAAAAGTCTCGTAATCGGTAGCAGCAGCCTTCAAATCTGTACCACTAGCCTCCTATCTCTGCCGTCCTTTTGCACCAGTCACTTT
CCAGTCTCCATTCTGCTGTTGAGCTCCTCGCCAGGCACCATGAGGAGCGATGCAACCGCGGAGGAAGTGGCGATGCTGCAGCGCCCGTTCGTGCGTGGCG
AGACCGACCTCTTCGCGTACCTGACGGCGCTCATGAAGCAGCGCACGTTCATCTTCGACGGCGGCATGGGAACCATGATCCAGACGCACAGGTTCACCGA
GGAGGACTTTCGCGGCGAGCGGTTTGCCGACTCTCCGTGCCTCGTTAAGGGCAACAACGACCTGCTGTCCATCACGCAGCCGCAGGTCATCAAGGACATC
CACAAGCAGTACATGCAGGTCGGCCGCGCGCAGCTCATCGGCACCAACACCTTCTCAGGCACCACCATCGCCCAGGCCGACTACCAGATGGAGCATCTGG
TCTACGAACTCAACTTTGAGTCGGCCAGACTGGCCCGGGAGGCGGCCGACGAGGTGACGCTGTTGGACCCTTTGCTCCCACGCTTCGTGGCCGGGTCCAT
TGGCCCCACGAACAGAACGTTGTCCATCTCGCCCAATGTGGAGGACCCAGGCTTCCGCAACGTGACGTTCGACGAGCTCGTAGACGCCTACTACACGCAA
GTGGAAGGATTGGTCGACGGAGGCAGCGACGTGCTGCTGGTGGAAACCATCTTCGACACGCTCAACGCAAAGGCGGCTGTGTTTGCCATTAACAAGTACC
AGGAGACCACGGGCCGTAAACTGCCGCTGTTCATCTCTGGTACCATTGTGGACATGAGTGGACGCACGCTGTCGGGACAGACAACCGAAGCGTTTTACGT
CAGTCTGCGCCACTCGAAGCCCTTCTGTATCGGCTTGAACTGCGCTCTGGGCGCCAACCAGATGAAACCTTTCTTGCAGCGCTTGGCTAATGTTGCAGAG
TGCTTCGTGTCAGTGTACGCAAACGCCGGGCTACCGAACGCCATGGGGGGCTACGATGACACGCCGGCCATGATGGCTGAGTACTGCGAGGAGTTCTCCA
AGGACCGCCTGATCAACATGATGGGCGGATGCTGCGGCACCACGCCCCAGCACATTGAGGCGATCGCCATCATGGCCGCCAAGTACGAGCCGCGGCCGCT
GCCGGAGCTCAAGGAGCCGTTCATGTGGCTCTCGGGTCTCGAGGACATGGTCGTGACCAAGGAGCGTTTCAGCTTCTTGAACGTCGGCGAGCGATGCAAC
ATTTCCGGTTCGATACGCTTCAAGCGTCTGATCATGAAAGGCGACTACGGTACAGCTATGGACGTGGCGCGCCAGCAGGTTGAAGATGGCGCTATGGTTA
TTGATGTGAACGTCGACGACGGTATGCTGGACGGTGTGGCGGCCATGGAGCGATTCCTGAAGATTGCGGTGACAGAGCCTGATGTGTCCAAGGTCCCTTT
CATGGTTGATTCGTCCAAGTTCCACATCGTGGAGGCCGGACTCAAGTGCGTGCAGGGCAAGTGCATCGTGAACAGTATCTCTCTCAAGGTCGGTAAGGAG
CTTTTCATGGAGCACGCCCGCATCGTGAAGAGCCACGGTGCCGCTGTGGTGGTCATGGCTTTCGACGAGGAGGGTCAGGCTGCAACTGAAGCCGAGAAGG
TACGCATCTGTAAGCGGTCGTACGACATTTTGGTGAACGAGGTGGGTTTCCCACCGGAGGACATCATTTTCGATCCGAATATTCTGACTGTCGCCACGGG
TATGGAGGAGCACAACAACTACGGTGTGGACTTCATCAACGCTTGTCGAATCATCAAGGAGCAGAATCCGTACTGTAAGATCAGTGGTGGTGTATCCAAC
TTGTCGTTCGGTTTCCGAGGCGTGAACGTTATTCGAGAAGCAATTCACAGTGTGTTCCTCTACCACGCTGTTCAAGCTGGAATGGACATGGGCATTGTGA
ATGCCGCCATGCTTGAAGTGTACGATGACATCCCTAAGGACCTCCTCAAGTTGGTTGAGGATGTGGTCCTTAACCGTAACCCGGATGGCACTGAGGCACT
CTTGGATCGTTCTCTGATCGAGAAGGAGAAG