Description :
From Genome Similarity Track
Location :
Scaffold_594:3035- 4197
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_594-snap-gene-0.3Isoform 5 of CCR4-NOT transcription complex subunit 4
Pytve_DAOMBR484maker-pve_contig_594-fgenesh-gene-0.1MAP kinase phosphatase 6

Sequence
1162 bases(100 bases per row)
TGAGCCCGTTCGACCAAGAGGTGAACCACCGGCACTCGTTCGGTGGCTATGACGGTTCCGGGTTCCCGCAACTCGCGCCACCTCCTCCGCAGCCTTCGAG
CTCATTTTCTAGCGGCCCAGGATTTGGACAGTCGCTGCACCGCACGACTAGCATGCCTGGCGAGGGTTCGTCGAACGGACTGGCGTTCCTGCAGCAGATG
CTGCCCAATGTGCATATCAGCTATGGCGGCGAGTACGCGGGACGCTCGAGCGAGAGTGGCAACCAGGATGCAGCGGGCGGGCGACGACTGTTCCAGCGGA
GCCACAGCCTTGGCGGCAACGCTCTCGGCTGGAACGAGGGTCTCGGCGGCAGCACCAGCGGCGGCAACGGCAACAGCGGCACGTTTGGTTACTCGAGCCC
CAGCTTGTTCCAGGACCCGGCGATCGTGTCGCAATCGACGCCAAGTTCGTTTGGCGGTGGATTCTATGGAGATGGCCCGATGGATGAGAGTGAGCGAGGG
TTGCAGTTTGGCGGTTCATTTGCAGTGCTGAACCGGCAGTAGACTCGGCAGACCCAGACAGAGACAAAAATGACCAGCGGGTTGTAAAGCCCGGCAGTGG
CGATAATCGAATGCAGCTCGACTTGGCAAGCGATGGCGCGTTGATCCAAGCATTGATTACATCGTGGAGTGTGGTGTGGTTGTCCAGGAATAGCCGTGAG
GCGTCGATGCCAGCAACGACAGCATGGAGTCTTCGTGCTTGGACGTCGCGTCGCCGCCGCCCTCCCCCGCCAAGGTCGACGATGTGATTGATGCATCATT
GCCACAGGACGAGGAGCAGGAGCAGGACGCACCACAACTGATCGATGCCGTCGACAGCGACGACGATGTGGTGCCGTTGTGGATCCGAACGACGTTCCCA
CTCGCTTCGACCGAACGAGACGTGACTGCGCTCGTGGCGAGACTGACTGCGGGCAGCGAGCAGACAGACTCAGCGTGCGAAGAGTGCGACGCTCGGACAG
CTCTGCTTTGGTGCACGGATTGCTCGCTCTCGCTCTGCTGGCGCTGCGCAGACGCCATCCACATTGTACGTCTCCGAGCTCGCTTCTTTTGCCAGACTTC
ACTAATTGCGTGCGTCTCCCTAGATCCCGATGTTGGCAGAACACTCCATCATCACCCTCATG