Description :
From Genome Similarity Track
Location :
contig_47:303473- 309025
Transcript NameFunction/comments
g7881.t1hypothetical protein PHYSODRAFT_313225
g7882.t1myosin-like protein

Sequence
5552 bases(100 bases per row)
TGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGATCCGCGCCGAGAACGAGCGCCTGTCGCGCGAGATCCACGCGCT
GCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGACGCGATTGAGGCCTCTGGCAGCGAGAAGGTGCAAACGCTGGCG
CACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCATGACGGAGATCCTCAAGAACGCAGACGCCCAGAACGAGGTGG
ACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGACGCTGCAGCGTGCCAGGGGCATGTCGATGCCGCGCCAGCGGCG
CTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATCCCACCCTCAGGAAAGCACAGCCCCGACGGGCCTCGTCCGCCC
AGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGAAAAAGAGTCTGTTGTTCTCCACTCACTCGCACTACGGCAACT
TCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGTTGCCTGTCCATCGCGTCGAGCCCACCCCGGCAAGAGAGAGAG
AGCACTACCTTATTTAACACCAACCCAGCATGTTCAGCCATTGGAGCAGCTAGCTATCCGTCTAGTCGAGCGTCGGGCGTCACGCCTGCAAGATCACACG
TCCAGATCACTCACCACCAGGCATTCTGCTGATATCCCCCGCTGCATGTTTTTCCGACGGGCAGAAAAGCAAGCAAGGCAATCGTTGGTTCAAAGTTCGA
GTGATGAACCACCAGAGAAGAAAGTCTTGGTATCCGCTATGCGTTTCATCGTACTCAGTCCCAGTTAAATACAAGTGCCGCATCACGTTGTGCTGGCCTT
CATCCCCTGCGAATCGTTTGCGGTTGTTGTTGCTGCTTTTCATGCTGCCTGAGTCAACTCGACCACAAGACCCTGACAATCAACACCAAGCACATCGACG
ATGGTTGATATCTTTATTATGGATGGCTGATGGTTGATACAAAGCTAACTAGCTAGCTGGACAACGCACTACTACTAGAGGGTGACACGCATATAATCGA
AGCGCCAAGAGCGGCAAACACGCTAACCTGCGAATTCGTGCTGTCGCCCCTGGCGTCTTTTCGTCTACTTACAGCGCGTTGGCCGACTTCTGGCGTGCCA
GCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTGCGGTTCACGTAGTACACGCGGCCCGTAGAGCGCGACACCTT
GGCTTCCCAGCCGACAGGGAGCGATACCTCCGGCAGAGCATCCAAGTTAAACGACTCGCGCACAGGGCGATCCACTGCGGGTTTCGCTGCCGACTTCACC
TTCGCGCTCTTCGAGGTAACGACCGTCGTCGATGCGACGTTGTCGGTCGTGCCCACCGTGTTGTCCTCAGGCTTGCTGTTCGTGCGCTTGTTCCGGGACG
CACTCTCGTACATGCCCTTCACGACGGACATGCGGCCCTTCAGGGTTGACATGGCACCCGTCACGCCCACCTCCATGCTCTTCACGATCGTGTTTCGCGT
GGTAGCGTTCGTGGGGCTGTCCTCACCGTCGACCTCCGAGACGTCGAAGCCGTCGCCGTTGTCGCCCTTTTTGTTAGAGTTCCAAAGGCGAGAGGCCACG
CTCATGCTCGGCATGCGCGGGAAGTGGCGCTCCGACGCGCCCGACGAACCACGGTTGAGGTCATCCGAGCCGGTGAGCGAGTCCATCAGCACGGTCTCGC
GCGGTTTCTTCTCCTTCTTGGAGCCCAGCGTACGGAAGATCGACTTCTTCTGCGTGGACTTCTTCTCGGGCACGCCTTCCACGTGCAGCTTAGCAAGCTG
CTCTGTCAGCTTCTTGTTATCGGCCTCAAGCTGCTTGATCTTCTTGTCCTTATCTCGCACAGTGTCCTGCAGCTGACGAACCTTGACGTGGTTGCCAGCC
GAAGAGAACTCCTTGTCGCTCTTGAACTTCTCAATTTCCGCCTTCAAGCCCTTCATCGTAACCTTCATGTCCTCGTTCTTCTCACGCAGCTTCTTGTTCT
CGTCCGTGAGAGTCTCGATCATGCCACCAGCGTCAGCCATGACCACACTGGATGCAGCGGACGTCTCCGCCACGCTGCTGCGGCGTTGTAGTTGCGCATT
ACGCTCCTGCTCATCTTGCAAGGCTGCCTTCAGCTTATTCAGCTGGTAAGCCATGTCAGCCTCACGACGCTTCTCTTCAAGAGCAGCCCGATACTTCGGC
CGCTGGATCGTCATACGAACCACAGCCTGCACGCGAATAACCATCGCGCGCATCTTAACGTAGCGGTGGCGCTTGACAAAGCCACGCACATACCGCTGGA
TGATAACAGCGTTGTGGTTGCTCTTCACATCGGCAGCAAACTTGCGGCCCTGAATGCCTCGCCAGTGAGCTTGCGCCAAAGTAAGGCCGTTCAAGAACGT
GTTGTATCTCCGCATGGCGATAACGCACCGGATCACCGACTGCAACTTGATAATCGCTTCCAGTTGCCGTAGGTACTTGATACGCTGAGTGAAGCCAACC
ATGACGTTCTGCAGATATGTGGCCTTGGCATCGAGGAATTTCTTACGGCGGTCCTCGAGCTCTTCAAGCACACCCAGCTGGAAGTACACACGGGTCTTAC
CCATCTGGTACTGCGTGGGCGACTCCAACTTCAGCTTGTCCATGAGCAGCTGGCACTTGTCTGCCGGCGTCTCGCCTCCGCTCGGCACAAACAACCAGAA
TTTGCCCAAAATCTCCGTGTGCTGCAACCGATTTGGGTACGCTGCGCGCGAAATACGAATAGCCTCGATCACACCAGCGCATCGCAGCTGGGATACCACC
ATGGACTGGTCCATGACTGTCGCGCTCTTGATCGGGTTGGGCTTAATGCAACGCACATAGTGCACACGGGTCGAGTTGATGGTAGCCATTAGCTCCGTCA
AGCTTTCTTTGAATTGGGTACCGACCGTCGTAATCGACAGCGCACCACCACGCTTGCGGCGGCCACCAGAAGCGGCTTCTGCCGCAGTCGGCTTCGGCTC
CGGCTTCGGCTCGAAGAGCTTTGCGATGAACGGCTTCGACGAACCACGCATGAGCTCAGACAAGTCAGGCAGCAGCGAGTCCTTGTGCTTCTCCAGGAAA
CCGACCGAGTCGTACATGACAGGAGCAGCATAGTGCTTGATAAGGAACTCGGTGCGCGATGTACGAGGGAACTCAATAACGTGCGCCATGTCATCCTTGT
GCAGCGACGTCACCTTCGACATGAAAGACTCCTCGTTACCCTTAGGTCGCATCACCTCTTCGTTAAGCAGCGAGATGATACCCATGCGCGACTCAATCAC
GCTCAGCACATCCTGGTTATCCGCATATTCAATGTGGTCCCACACGATACCTTCTTCCTCGTACTCAATTTGCACGGTCTTGAACACATCCTGTGTGAAC
TTCTGTTGAAGCTTCTCATTGGCGTAGTTGATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGCTCGAAACCGAAGATATCGAGCACACCCACGTGGT
TTGCCATGTTTGCATCATCGGCAAGCGACTGGTTGATGGTAGTCACCAGCCAGTCGAACACGTTGGAGTAGATAGCCTTGGAAAGTGCATCACGGCAGTC
CATAGCCAGTTCCTTGCGCAGCGGCACGCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTCTGAAGCGCTTCCCAGGTGACACCA
AGCATCTGAGTGGCAGCATTGGCACCACTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACTGCAGTTGCGCCTCACCAAGGTGGA
GCACACCGGCAAGCACCTCGAATAGCGGCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGTCTTCTTGAAGTGCTTCTCATCCGA
GAGTCCTTCGATCTTCTGTGCTGTGTTGTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGCGCAATGTCGGAGCTATCCAGCAGT
TGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGACACTTGGCACCAACAAGCGTGCCGT
TCTGGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAAGGACTCCAGCAGCGGGTTCACCTC
GATAATCCTCTTGATGGTCGAGTTGTTCATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTTTTACCAGCACCGGACTCA
CCACTCACCAGAATGGACTGGTTGATCTCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGTGCGGCGGAAGCTCCTCCTTGGGCT
GGTTGAGGTATCTCAGGTGCTGCTCCTCGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAATGTCGCCCGTGTAGGTGTACGGCAG
CTCGCAGAGGAAACGCTTCTTGACATTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCAATACCCTCGGGCCCGACGTTCTCG
TTCTGGTAGGGCAGCGACTCGAGCTGTTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAACGCTCCTCGGTTTCGCCGTCGGGCA
GCTCCACCTTGCACGTGATCTTGCGGATCTTGCCGTCGCCCGAGTTCTCGTCGCGAGCACCTCGGCTGCAAGCCATACGTGCGTCTCGTCTGGCACGAAG
CACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAGGCGGAGAGGTGCGCGGCTGACGGC
CCAAAGCGGAATGCGGCAAGGGGGCCAACGCACCAAGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAGCAACTCGACTAACTTGCGATTTGT
ATGAGTTGCTCTGATCGGGCAACTAGAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTCGCCCCGTGAGGATTTGTGCACGCT
GTGCCGGCGAGTAAAGGCCCGAATCGAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAATTGCGATGCGTGCTTCATGTGGTCG
CGTATCCCAGCCAAAGCTTCTCAGGCGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTCGTTTTCTGCTCGACATGATTTACC
GCGAATGGTACCGGTTTTACTTATCTGTCACACGGCATACCTTGTTCAAAAC