Description :
From Genome Similarity Track
Location :
Scaffold_284:30332- 32840
Sequence
2508 bases(100 bases per row)
ACAGGTCAGCTGGCTCGTGTACTCCAAGATGGAGAACACGTTGCCACTCACGGCTTCGGACATGGCCGCGCGATAATCCTGGGCCAAGAGCATGCTGCTG
CGGGCGGATGTTGGGTCAATATGGGACTCAATCATTTTCCTAGACGAGAAGAAATGGAATTCAGATAGACCTGACGGCTTCCAGCGCTACTGGCACGACC
TGCGCCAGCCCTCCCGCCAGACGAAGCTACGTCAAGGAGGTTGTGGGTTTATCATGGTCTGGGCCTCTTTCAGCGCCCGTGGCAAGTCGCCACATGTCGT
GCTGACGGGGAGGCAGAATTCAGAAGACAACGTGTACACAGTGTCTGAATATCTTCTCCCCTTCGCACATCTTAACTACGGCACCTACTTCATTTATCAG
CAAGACAACGCCAGCATACCCTATTCTCATCTTGGCCGGAAGTTCTTTAATGAAGAAGGAATTCAGATACTGGCCGTCAAAGGCACCCGATCTCAACCTC
ATTGAAAATTTGTGGTCGATTATGAGCCGGCAAAAATACGCTAATGGAAAATATTTCGAGCGCGTCTCTGGCTTGAAGGCAGCACTATTCGAGGCATAAG
ATACAAGAACGCATGCCAAATTATTGTCGCTTGTTTGCTTGATGCCTTGACGATGCTTTGAGGTTGTCAAAAAGAAGGGCAATGAAACGCACTATTAAAT
ACAAATAGTCTTTACTATTTTCATTGATTATACTTAGAATTTGTATAGGTCGTGGAGTACGATTTAATGTGTCGCAGTGGCAAAACAAAATTTGTATGCA
AGACCCCCTGCGCTTTGTGAATTCGCGATTGATTGCACACATGGGTTGTTACTACTAATGAGCTAAACTACAAATCGAAACAGCATCCGCAAATTCCAAA
ATTGACTGAGCAGTGGACGAAAATATGGGTGTACGATATTACTAGTCGTGGAGTGTACAAGCACCATTCTCATTGGTAGCCACCAATGAGATAATGTACC
CTTCCGAAATCAATAATATTTCCATTCGGCGCGCTTTTTGAAGTCTTCTTTGGCGTCATCTGCTCACCACAAGCCAACACATGAGTAAACACGACATAGC
GAGAGGGACACGGATTTCAACTGCCTCCGCCTGCGAACCGGCTGACAGCGGATCAGAAGCTGATTCTTTGCAAGTGACACAGTGAGAACCCAAGCCTTAG
CTGCTTACGCCAAGTATATGGGCTGGCTTTACGTCTCACATGTTGTGAATTGTGCTTGCCACTGATGTATGTACTCGCTGCAGTAAACGTTGAAGCTTAC
GAAGAACCCGTGCGTTCAAGAAGCCTGTCACCGAAAACGCTGTGCGTGCAAAACAAATCAGTATGTATGCTAACCGTCCCTCAAATACGCTCTCGTACTC
TGGATCAAGCTATACAAGCTGTACATATGCCGGTGGTCACGTGGGCTGAGACGCGCTCGAAGGCGGAGAAGACTCGCAGCAATCTTGTGCGAGACGCTGC
CTACGTTCCTAACGCGGAACTCGAGGGCAAGGTGTTCTCGGATGGGTGGCTCCAAAAACTACAGGAGTGACATGGGCTGAAACCACGAGGTGTAAATGGA
GAGGCTGCGTCCTCGCGTGCTTCTGAAAAAGATATGCTAACCTCATAATAAAAGGCTTACATGAAATTGAACTGGGCGGTAAAAATAGGTAAATCTGGCA
AGCTGATGTTACTCACAATTTGTAAAGTCGATGAAGGTCATGCTACCATGAGAATAATTACCAGCAAATACAGCCGTTGCGACATTTTCAGCATGGTGAA
TCTGCGTATTTTTACAGCATGGCGCCTTCAACTTCCGTGAAAAAAACGAGCATATCAGGGGGAAGAAGATCAAAAAGAGTCTTGCGGTGTCGATCGCGAC
CAGGTCCTGTACGTGCCACTTCTCTTTATCGCAACAGCGAGGGAGCTTCGGTGCTTCAATTCGGAATCGGCGAGCAAACGCAGTGTCGACTTCGCCAATG
CTGCGAAAGGATGGATGGCGACTGCGCTTTTTCGGTGCTGACTGGCGCAATTAAACAAGAAGATGCAGAGTTTGTGTCGCGTGTGCTCCTACTGCTCGAC
AACGCGTCGCCGCACCGAGTTTGCAATTGCTACTAAGTCGTCGTACAAGCTACGAGATGGACGACAAGTTGTTCACCACAAATGTTACCGTGGAGGAGTA
GCGTTAAATCTTCACGAAATTTCATAAAAATTAGGAATGCGGCGGGTAGTTGCAGCGTTCTTGTTGATTATACTTCCAGAGGAATCGAATGACAAAATAA
GTACAATAAAACCTGTGTAACGTTATACTGTCTAAAGTTTCAAGGTTTAGTTGGTCCCAACTTGGGTCCTTTATCTTTGGGAAATACTATGCTCTACCTG
TCGAAAGGTTTAACCTGTCTAAAGTTTTAACTTTTACCCGGTCCGGAGGCTATACCTTTAAACAGGTTTTACTGTATCTCTCAGCAACAATGATGATTTC
AATTAGAC