Description :
From Genome Similarity Track
Location :
Scaffold_3:30331- 38329
Sequence
7998 bases(100 bases per row)
ATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAG
ATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGA
GACTTAGGATTCCTATTGGCTGAGAACAGCATCTCTTTGCCAATGAGCGACATGCATAGCATTGGAATTCTGCTTAGAGGAAGTCAGAAACATAAAACAA
AATAGCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGTAAAAGA
AACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCATTACAACTCCATTCACAAGTGTATAGAGCTGCTCG
CTCTCGCGTGGAGCCTCACCGCTCGACACGCCCTTCTCGACTCGTGAGATCGCAGACGCCTTGCGTGTCGCAGTCAGCGCTTTGCGGCGCTGCCTCCTCT
TCATGGAAACCGTCCGCCCTGAAGAGCCCCGTGATTTCGCGTGCGTCTTGACGCCAGGTGTCACCACCTCGTTCAGCTCCAGGGGAGCTCCAGTGTCTTT
ACCGACACTCAGCGAAGAGCTGCACGATCCGCAGCCTCCACTCAGTGGATTACGTGCCACCCCATGATCTTCATCCGAGCAAAGCCCCTTGTTCTTCGGC
ATCGTGCCGACCGCGCCGTCGCTGGTACGCAGTAGGGCGTCGCCCTCAGACGCACGCCCGCTAAGCGGAATTAGTGCCGCTCCACATCCATTATCCGGGC
AACGCCCATCTTCACTCGACTTCCTGTCGACCGCGCCTTCACCGGCACGCAGCAGGGCGTCGCCCTCAGACGCACGCCCGCTCAGCGGAATTAGTGCCGC
TCCACATCCTTCAACAGCCGGGCCACGCCCATGACTCCTCGGCTTCATGCCGACCTTGTCTTCACTTGAATACAGCAGGGCGCGCACACCCGCTCCGCGG
AATTCGTGCCGCTCCACCTGCCGTCCGCGAGCCACGCTCGGAACGCTCGTTCTCGACACACTCAGTGTCCACCAACTCGGAAACTCCGATGTCCAGCACA
TTGACCGACTCGGTCCAGTGCTCGCGCCAGAAGCGCTTCTGCTTACTAGCAGAGGTGGGTTCATGACTCGCCAATGCTCCGCCAGGAGAGAAGTGCGTAG
CGCCAAGGGTCTTCGACCTCCAATCAATCCAATGCTCGTGGCGTTCCAGCCACGCCATACCAAGGATGAGATCATATCTCGAATCGAGGTCTATGACCAA
ACAGCGTTCCACGCTATCAAAATCCAAAACCTTCACGCCCAGGTCCACATGGACCTTAGGCACCGTGACACGAGTGCCCGTCGCGAGACGAACAGTGACG
ATGTCACTCCCGCGCGCTACCAGCGCCTCAGCATAAAGCTGACTTCCGTCCATCGTAGAACGCCGGGCGTAGTTACCCGACGCTCCCGAATCGATCAAAA
TCGTCCATGGCTTCGTGAAGCCCTTCACCCAAGCTTGGACAACTAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAGAGAGCCGTACTCTCTTCGGGGC
TAAGTCCTGTCGACCTCCACCTCGCCGAGGCTCAATAGAGCTTAGTTCTTCCCCAGTAGGCCGCCCGCGCCTACTGGGACTTCTCGTTTCCCCGAGACAA
ACCAGAGCCCTGGCTCGAACTCGAAGAGCGGCTTGACGAAGCCTGGCGCTGATGGCGCAGCGGACACCCAGCACGAAGGTGACGGATGTCACCACAGATG
AAGCATCTACAGATACCGCAACGCTGCTCAGCAACACGAAGCCCGGCTTCTTCGTCTTCAGCATAGCTGAGGTCCATGGGTTCCGGACTACTCGACACGC
TAGCGTGAGACGCATTCCACCCAAGTCTCGACGACTTAAAGTTTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAG
CTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGTCGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCG
GCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGTGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGT
GTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCG
GCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCT
CACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGTGTCCGGGCGGCTGTCGCGGA
CTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGG
ATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTATGGCGTGTTTAAGT
TTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCA
AGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGTGTCCGGGCGGCTGTC
GCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCGTGGCC
GGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTT
TAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGA
GTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGTGTCCGGGCGG
CTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCG
TGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTATGGC
GTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCG
CGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGTGTCCG
GGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGG
CGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCT
GTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTA
ACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGT
GTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGT
CCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGT
GTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTG
GGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCCGGC
GCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAG
GGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGG
TTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATC
TATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGG
CTGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGGGCT
GCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTTGGAGG
CGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCG
AAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGCCGTCT
GGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAGTTGTG
GTGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCTGCGTT
GGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCACGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGCGATAG
ACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTTTACGC
CGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTGCAGAG
TTGTGGTGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGGCGGCT
GCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTTAAGGC
GATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATCGCTTT
TACGCCGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAGCGGTG
CAGAGTTGTGGTGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCTTGCGG
CGGCTGCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAGCGGTT
AAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTCCCATC
GCTTTTACGCCGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGTGGGAG
CGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTACAGCT
TGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTATGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGGCCGAG
CGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCTCGTTC
CCATCGCTTTTACGCCGTCTGGAGGCTGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAAAGCGT
GGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGCTGGTA
CAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAGCTTGG
CCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTGCTGCT
CGTTCCCATCGCTTTTACGCCGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAAGCAAA
AGCGTGGGAGCGGTGCAGAGTTGTGGGGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGTGCGGTGC
TGGTACAGCTTGCGGCGGCTGCGTTGGAGGCGTGGTTTGTGTGCTGTGGCGTGTTTAAGTTTGCGGCGCGGTGAGGGTGGTGTCGTGGATGCTAGGACAG
CTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGATCTCTTTATGTCCGCGCCACCTG
CTGCTCGTTCCCATCGCTTTTACGCCGTCTGGAGGCCGGCGCGGTGTCCGGGCGGCTGTCGCGGACTCCGGCCAGTCGTATGGGCGCGTCGGTGGGCGAA
GCAAAAGCGTGGGAGCGGTGCAGAGTTGTGGTGCTGCCAGGGCGTCCAGGCGGCGTGGCCGGAGGATCGTGTGCGCTGGCCGCGTAGCCAAGAGGAGT