Description :
From Genome Similarity Track
Location :
Scaffold_765:3033- 5251
Sequence
2218 bases(100 bases per row)
AGCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGATAAGGGTGAT
CAGTCACTAAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGCTAAACTCTTCTTCACTTTTGGATGAAGCTGTTCTAGAGG
ACACAAAAGCAGCACTCAGTGCGCGTAGTAAGTCCTCAATATTGAAAGGCCCTCATGATCCCTTTTATCCCTTAGTCAAGGAATTTCAAAATGTGTGTGC
CACGACCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGATCCTGGGACGGAATACTGTGTCACACGACAGTGGCACTTGA
CTAAGGAGCAATGTGAGGTCATTGATGATTTCTTCCGTGACAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCGCATTCGACACCGACGTTTTG
TGTCAAAAAGCCGACCAGCAAGTGGCATATTGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCACAAACACTCATTCCTCGAAAGGATTTT
CTTCAGAACAACATGATTGGTTGTACTATGTATAACGCACTCGACTTGTTCGATGGATATTATCAATTTCTTATGCAAGCTAGTGATAGTCCGCTTACAG
CAGTAAGCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGATGTCTAATGCTCCGGCAACATTTAATCTTCTGGTCACACAGCTTTT
CCGCCCACATCGGGATTACGCACAGACGTACTTTGGTGACATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGACAACCACATCGATCAT
TTGCGAGCCGTGCTCGAGTGCATGCGCACTAATAAATTGTACGCCAAACGCGTCTAAATGCATTTCTGGTGCAGAAGAGATTCCTTTTCTAGAATGTTTC
ATTAGTAAGCGCGGCCTTAGAGCGGATCCCGCTAAGGTCAAGGCTATAGTGGACTGACCGATTCCTAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCC
TTGCCAATTACTTGCACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATCAACTGATCTCCTTAAGAAGGACACAGATCGGCGTTGGGACAACAC
CCATACTGATGCATTTCGGGAAATAAAGTAGAGTCTCCTTCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTATCTGCGATGCA
GCCAACTTTGTCATAGGCAGCACCCTGTTACAAACAGATGTTGCAGGCCACGAGCGAGTTATCGCATTTTAATCTAGTCAGCTCAATGCTGTTGAAAAGA
ACTATCCAGTTCATGAAAAAGTGCTACTTGCTATGAAGTATGCGCTCGCCAAATTCAGAGTCCATCTGCTTGGCTCCAAGCAATTCGTCGTCGATACGGA
TCATGCGTCACTACGCACGGCAACACAGTCGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAACATAACTTCGAGGTGAAGTAT
AATACAGACAATCAAAAGGGGTTGGCATATGCCCTCTCTAGCCATCCCGATTATGAGCTTGTCCATGTCACGACTCTGTCGTCTCCTATTGAGGAGTTAA
TTCGTGTGGCATACCCACGGGATTCTCAATGTGTGGCATTGTTTCATGCCCTTGGGAGTGAGGAGTGCAAAGCCTCGGACAGCCATTTGTCGGCACGGTT
GCGTGCCAGCCTACATCGATATTCCATCAACAATGGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTGTACCTCACGATGAGGAT
TTAGATTATCGAATCCTT