Description :
From Genome Similarity Track
Location :
Scaffold_13:30319- 31924
Transcript NameFunction/comments
Phyke_g919hypothetical protein

Sequence
1605 bases(100 bases per row)
CTCAACTTACATTAAGCATCGCCGTGAGTTCTAAATGACCACCTTGAGCTGCCCGAGGtacccacagcaacaacgaccCACCACCCGTACCGGGAAGACC
CAGAAAACCAGGCCGCCACCGGTCCAGGTACAATGTCTTGCCTCCCAGTGCCGTCACATTCGACGTCCACGTCACCGTCTCGCCTGCAGCAACGTTTACC
TTGTCGAACTTGTTGCCACCGGATTTAATGTTCACGGTCACATCTTCCGTATCGACGCTTTGGAAAGTAATGGTGAcaatgccatcgccaaccTTGGTCC
AGGTACCAACACTGTTGGTGAACGCATCCTGTACGGTTTTAAGACCTAGTGCCTTGCCGGCGCTACCGTCATCGATTTCACCAATAAACTGTGTGGGTCC
GCAAATGGTCTGGAAATACTCGGAAACTACACCGGCGATATTTGTCACATCCCACACCGCGTAAAAGGTGAGAGCTTTGTCAGCGATCTTGTAAGCGTAC
TCCTCGGCAGTGAGAAAtgtgccattgctgctagTTCCGGAACTGATGAGATCGTCCACGATACCCCCAAAGGTTTTACGTAGATTATCACGAATAGAAT
ACGCCGTGGATGTGTCAGATTCAACGACCAACTCCTCCATGCAGTTATTCGTGACAATAGGAATCTCATTTAGCACAAGGTTTGACTCACTCATTATCAC
ACGAATGTCGTCCTCTGAAATATCAGGCTTTTGCTTGCGGAGATCTAACACGGTCATCCAGGTGCGGTCAAGAAGTCGTTTCATGTCGTACCCGCAAGTC
GAGTTAGATTCCAGTGCGGACTGTAGTGAGGAGATATCCGTCTCGCTCAACGAGTCGAGCGACTCACCCAGCGTAATGTTTTTAATGAAAGCCGCGAATG
TATCCCAACTTGAAACAATCGCATCGTCATTCGCCAAGATTTCTTTCAAGGCGTACTCAGCAGTGGTGAGCACCCTGTCGGCAAATTTGATGCTATCATC
CAGTTTGATGTCGAGACACGAAGCGACTGTCACTGGTAGGTCTATAATAACGTTATCCGTCTGGTacaacatcgtcaacagcTTGTCTTGCGAAGTCAAG
GGATCCTTGACCTTGACGTTACGGACGTACTTGGATAGCGCCTTGACCAAACCCAACATGTTCTTACTGCATTTGATAGCGACTTGGAGGCCTTTTGCCA
TCAGCTTGAACTCGCCGTACAAGCCCAGTGTAGCAAAGGATAGTGCTGATTGAGCCACAACAGAAACTTTGGTCACGACTGCAAGCGCGCAGTCATCGTT
TTGACGGATGCATTCCAATCCACACTCCACGGGGTATGAGTATGGGCATTGCGCCCAGCACATGCCTACACTACTGTCGAAATCCACAGGACATGCATTT
GCAATGTGGGCCTCACGGTAACACGCCGTCGTAGAAGTAGCACCAAGAGCCGAGCCAACCCAGTTGGCACACGTCGACTCGACTGTGCTGATGGCACTGG
AAACACTACCAATCGCGATCGCCGCGTTCGTGGAGGCAGATCCAGACTTGTCCGCCGATACAGGAGTAGCCGTGGAATAGATGCCACTGCCGTCGCTGCC
ATCGA