Description :
From Genome Similarity Track
Location :
Scaffold_307:30317- 31439
Sequence
1122 bases(100 bases per row)
TTCGATGGCGTGACAGGTCACGTGGAGGGTGAATTCAGCCTTGCAGCCCTCCCATCGTTAAACGTTCCGTTAGAGCTAGACGAAATGTCTGTGGATGAGT
TCAGTCATACTTTGAAGGCAGGCGACTTATTCGATATGGTAGTCTTTAGACCTGAAAACGAGTTGAACTCCTCTTCCCTCTTGGATGAGACGTTACTTAA
AAGTACAAAGGCGGCACTTAGTGCACGTAGTGGATCAACCATTTTGCAGGTCCCTTCATATCCCTACTAACCTTTGGTTAAGGAATTTCAAGACGTGGTA
TGTCACAATCCATTATCTGTATTATCTCCCGATAGGGGCGTACATCATGAAATTGACTTGATTCCTGGAACCACAAACTGCGTTACACGGCAGTGGCCTT
TACCAAAGGAACAATGTGACGTCATTGACGAGTTTTTCAGTGCTAAGCACGCGGCAAAAATGGTGCGCGAGAGCAAGTCTCCTCATATCCACGCCGAAAT
TTTGTGTCAAAAAGCATAATGGCAAGTAGCGTATTGTGCACGCTTATAATAAGCTTAATGCGGCCACTATACCGGCACAAACACCCATTCCTAGAAAGAA
CATTCTTCAGAACAACATGGCAGGATGTACAATGTACAGTGCACTCGACCTGGTCGATGGTTATTATCAATACGTGCGAGCAAGTGATATCCCGCTTACA
GCGGTTAGTACTCCAAGCGGTATGCTTTGGGGGTGGCTGGTTATGCCCCAGGGACTTTCCAATGCCCCGGCTACGTTTAATCGTCTGGTGATGCAATTGT
TCCGCCCTCACCGTGCGCATGCACAGACATATTTCGATGACATAGTTGTCCATAGTCGGGCAAACCAGGGTTGGTTGGACGTGGATAACCACATCGACCA
TTTACGAGCTGTGCTCGAGTGCATGTGGCCTAATAAGCTCTATGCTAATGCATCGAAATGTATCTTTGGTGCGGATGAGATCCCATTTTTGGGATGCTTC
ATTGGGAAGCGAGGCCTTTCGATAGATCCTGCAAAGGTGAAGTCCATAGTAGATTGGCCAGTTCCTAATAATCAAAAAGACCTACGAAAATGGCTTTGTC
TTGCCAATTACTTGCGTAAGTA