Description :
From Genome Similarity Track
Location :
Scaffold_8:30311- 33397
Transcript NameFunction/comments
Phyra_74407Hypothetical protein
Phyra_74408AC079874_19 unknown protein
Phyra_74409CorA Metal Ion Transporter (MIT) Family

Sequence
3086 bases(100 bases per row)
CGGGAGATTCCGGGTACGCGCATTCACAGCCGCTGCTGAATACGTACCTTTCGCCGTCTTCGTCTTCATCATCCGACTTTTCCTCGGGTGCCAGTGATTC
CAGTGATGGCGATAGTGACGATAGCGATTGAGCGCATGGCAGAAGGGTAACATACAGGGATGCGAGTTGTGAGTGGCAAGAAGCAGTTGTACGTGTGTAA
TTTTGACTGGTGTCGCAAGAATCGGTGTGCAGGCGGCAAGCCTGGCATGTGAGTGTAAAGCATTCCTTCATTGAAAATCCCTCCTCCAGCAGCTTCTTCT
ATAGCATTACCAGAAGTAGAGCACGTGCAGCAAGAGCACGAAGGCAGCGAGGTAGCTGAGGTTTACCTTGCTAGCGAGGAAGCGGAAGTTAAACCGGAAG
CGTACGAATGGGCTGGCAGGGTCCACCTCCAGATTGTCTTCGAGCCGCTTGCCGTGGTACGGGTTCACAAAGCCGAACCGAGCGTTGAGCCACATCGAAA
CCTTGTAAGACAGTCGTACGAGCCACACCACTTCGTACGAGCAAATTGGGCTGAGCATGGGGTCACCGATGTACTCCGCCGTGTCGGGGGAGCACAGACG
CATCCCATGCTGCAATTGAAAGACACCCTCGCGAGAAAGCAAGTGAGGAAGATCCTTGTCACGACTGGGTGCAAACGACTCAAGACCTCCGCCCGCGGCA
GCGGACGATGAGCGCGAGTGCGCAGTTGAGGCCACATAGGCATCGGAGATCTCGAACACTCGCCGCAACATGCGACTAATGCGCTGCACTTGCTCGGGAA
CCTTTTCCACAGGCTTCGTGTGTGCCGAGCGGAACACAGCGCTCACATTCTGATACAAGTCGGCTGGAGAGTGCACAGAAGTCGTCGATGAAGGCGATGA
GGCAGCCGTCGCAGCAGCTGCCCACAGCTTATCAAAGAGCCGCTCCGCGTCGCGATGGAAGCTATCGTGCAGTGGCACGGGTGTGCACTCGATACCCAGA
GATTTGCAGTAAAACGTCAACACGTGTGCTTGAGTAGCTGTAAGTGCGTCCCCAGCCGTAGGCTTGGACTTTGACGAGGAACCGAAGCTTCCGCTGCGAG
TGCGTGTGAAGTTTGAGCTGCGATTGAAGCTGAACGGCATCGCAAATGGCTGAGACTTTTCGAGGTGAAGCGATGCACGGCGGAGAAGTGCCAATAGGTC
CGAGTTGTACACACTCATCACTCGATCCACAATTTGCAGGCTACGCTCATCGCCTGCGGAGAAGTCCAGCTCTTTCGCGCGCTCCACAAACGCGCCAAGC
ATCGTTGTGTAAAAGTGGTAATTTGCCAACACGTAGCTTTCCCACGCCGAGGTGTATCCTGGAACTGAGTCCTGTTCTCCTCCGGTGGCTGATGTCGCTG
CGGCTGTAGCTGGATCCTTGGATTCGATCCACGCCCGACAATTCCACGGCTGAATATACGCGAGCCAAACATCCGTGATGGCCAGGAAGGCGGCAGGTGA
GAGTCCAATGGGAGCACGTGAGAACACGAGGCGGAAGAATGCGTAAAGTGGTGGTCGCACCATGGTGACGCTACGACTCAGATACACACCAGCGCCCCCT
TGAGACCCACTTGCCGAATCCTCTGCCAACGGTGCAGGGAAAAACGAGTCCGAGAGGAGATGAATAATTGTGAGCAGGAGCGAGCTCAGCAGGTCATCCG
ACGGCGCCATATAACTCGTCGACGTGTACACCGAAGCAAAGGGACTGACCATCATGTTGCCCGGCGGTGGCGGGCGAAAAACACCAGGCGCCGCAGTGGA
AGCCCCCACCGGCTCATCCGAGAACGAAATCAGGTTCTGCCGCAGCCAAAACTCAATCAGGATATGAAGAAACAGGTTCGAGTCCTTCAGCAGTTTGGCG
TGGAAGCGGCTCTTGACGCCTCGGTTGCTGTCGGGCAAAAAGGCTCGCAAGTACTGCACTAAGAGCACATTGTACGGGTTCCCTCTCGTCAAGGCAGCGA
CGCCGTCCTTGACGAACATGCGCCAGCTGGACTGGCGCGTCTTGGCCGCAGCCGACAGCGCGCTCGTCGCCGACGTCGACGCCGAACCCGTGGAGGACCC
ACTCGGGTGCGTCGACGATGCCGGATGCCTCAAAAAGTAGAATAGATACAGCTCCGTAATGGACACGAGCAGCTCCGGGCTGCGCATATCCAGGCGCTGC
TTGGCCAGCGGCTTGTGCAGCAGCTGCGTGAAGAGCAGACTCGCTCCTCGGCCGCTGACGATGGCCATCTTGCTCTGCTCCGGCAGCATGGCCAGCGCCA
GCTTGAACTCCACGGGGTGCGGCACTCGGAAGAGGAACTGGAAGACCGATCCGTCCTCGGCGCGCACACCACCGCCCAGCAGCTTGACGATGGCGCGGCC
GCTGGCGGTCAGTGAGGCCAGCAGCGGCTCCACGTCGTCATCGTCCGTGGCGACGCCCGCCATTGCGCGCGCGTGCCGTTGCTCGGCGCGTTTCTTGGCG
GCCAGCGCCGCGGCCGAGCCCGGGGCGGGCGTCACGCCCAGGCCAGCGCTGTGGTCCAGCCAGCCGCCGAACTTCTGCTTGGAGACGGTGTCGTTGCCGA
AGACGCGGTCCAGCAGCTGGTTAAAGCGCTCGTAGAAGACGCTGCGCACCTGCGCCGACTGCCGCTTGGCCGCCGCACCCCCCGAGAGACCGGCTTGCGT
CTCGGCCGCCAGGTAGCGGCGCAGCGCCTCAGCCACGACCGGCACGTCGTAGGATTGAAGCGCGCGCTCAAAATCTGCGTCTGACTCGCTGAAACTGAGC
GCAGAGGAAGTGCGCGCTGCAGCGGACGCGCTGGACGCGGAGACGGAGTCGCCCGGCATCTGCATCAGTGGCGGCAACTCGAATGATTATAAAACACAGT
CGAAGGTTTATAACAGAATCAGTCTGGTATCAGATGGGATTTTTAACTTTGGTATGGGCTTTTTACTGCAGTAGGACGCCTTTGCTTTTGAAGTAGACGA
TGCCGGTGATGGTCATGACGAGGAAGAGACCGACAGTGAGGATGATGACGCCGAGGAACCAGCCGTCGGCCGACTCGAGACCCGAG