Description :
From Genome Similarity Track
Location :
Scaffold_105:30309- 32111
Transcript NameFunction/comments
Phymu_g4417phospholipase D, Pi-PLD-like-1

Sequence
1802 bases(100 bases per row)
cttcaatgGGCATTCCTTGTTTTTTTattcttttttttattgttATTCACGTTTCACATCGTGATTCAGTTACGAAGAAAAAGTAAGCGAAAGCTATACA
GACACATTAGCCACCAGACTACGCTTAGTCGTCGCCCTCGACGTCCGGGTCCACAATCTGGCGCAGAGCATCCGGCACAAAGTCGAAGGCGGCGTTGTCC
GACACCGCGTACGGCTCGATGATGCTCTTGCCGTCATCGTGggccgccgcctccagcgcgtcgcaagcctccaggaacgtcatggcgtccagctcATCGT
GCGTCAGCTTCGTCGCCTCCATGAACTTCTGGATACGGTAGTTGCGCACCAACTTGTTCACCGTGATGTTGTCAGgcgactgcaccagctccgtgtcCAC
AATGTTGACACCGATCTCCGTGTCGCTCGTCATACTACGGCGGTTCCAGTTGGCCGATCCCAGcgacacgtacacgtcgtccacgatcaCCAGTTTGCTG
TGGATGTACAGCTCCTTCGACTCCTTAGTCGAGTACAGCTTGAACTTCTCCGGGTACGCCTTCTGGATTGGGGCGACCATGTCGTACAGGTACTTGGCAT
AACCAGTGTAGCCAGCCTCCACGGTGCGCTGCACGATGACAATGAGGCGCTCGATGCTGGGCATCATATCCATGAtagcctccagcagctccggcaccAG
AATGAAGTACTGGTCCTGGATGAAGATGTAGTTCTGCGCGTTGCGGATGGCCTTGATACGCGCGTGGAAGATGGACTGCTCTCCCTGCGGCGCGAAGCCG
TAGTGGTCGTAGTCCGGGCTGAAAGTGCGGCACAGCTGCACGGCGTGGGTGCCGTCCGTAGGGATGTCCAGAGGGATCTCACCCTGGTCAATAGGGGGCA
GTTGAGCGTAGTCTGGGTTCTCAAAgtccagcaggtcgtccatCAGGTCCTGGGACGGCTTGTCTTCCGAGTTCCATCggtcgaagaagttctgcGCCAC
GTCCTTAGTAGCCGGGCCTTCAATACGAGCGTGGGCATCCAGCCAGCCGTTCCAGAGGGCCTTGATGCCCGTGCGTTCACGGAGTTCAGCCTGGTCGTGC
TCGATGGTGTCCCAGCGATCGTTGGTGAGATCCACACCGCCAACGTAGGCCACAAGATCGCGGCCCTTACGCACAATGACCGACTTCTGGTGGTGCGACG
ACGTGGCGTGCGGCAGACGGTCGTCGTACACGAAACGTGCCGGTCCGTGCTGCTCCGGAGGCGGTAGAGCGTTGATGAGGTCGCGCACCTCGTGGTTCTG
AGCGCGTTCCGTGATGTTGGACCACACGAGCATGCGCCAGTCGGCTCCGCGCTTCACGGCGTGCTCGGCCAGGTCCGCCAGCTTAGTGTCGGGCTCGTGG
GGCTTGAACGGGACGTTGCAGGTTCCCCAGCCGGTGAGGTAGACCAGGTCTCCACGACGGACTTCCAGCATGTCGTCCGCCACATCAGCGAAGTACGGGG
CGGAGGCCACGTAGAGCTTAACGCGGTTGCCCTTGGTGTAGAGGTGGATGCCATCGCGCTTGTAGCCGTCGCGAGACGTGCGCATCTCTTCCTCCGTGAG
GAACCAGCGCGAAGGCTCGAGGTAGGGCTGGTCGAAGGGGGCGGTGGCCGCCTTCtcgggcttcttctcgctctggaACGGGTCCAggatgaagtggaag
gcGCGACTGAGTCCGTCCATGGCGTAGAGAGGGGGGAAGGAACGAGGGGCTTGAGCTCGACTGGGCGGAAGCTGGAATGATCAGGCTGGAAATGAGATCT
TG